For genotyping, PCR-restriction fragment length polymorphism was employed. The PCR was carried out in an AmpGene DNA thermal cycler 4800 and reaction mixtures of the total volume of 25 μL included 10 μg genomic DNA, 5 pmol of each primer (Promega, Madison, WI), and 1X PCR mix (Taq PCR Master Mix Kit, QIAGEN, GmbH, Hilden, Germany) containing 200 μmol/L of each dNTP, 5 μL of 10X reaction buffer, and 1.25 U Taq Gold Polymerase and 4 mmol/L MgCl2. Primers 5′-AAGGGCTCAGCTGAACCTGGT and 5′-CTGCTGAAACAAATGAAACCC (Fermentas, Berlin, Germany) were used to amplify the 152-bp DNA fragment of the CTLA-4 +49 A/G polymorphism. The PCR is followed by an overnight digestion with the restriction enzyme BstEII (Fermentas). All PCR products and the fragments were resolved by electrophoresis in a 3% agarose gel after staining with ethidium bromide.
Bsteii
Manufactured by Thermo Fisher Scientific
Sourced in United States
BstEII is a type II restriction endonuclease enzyme that recognizes and cleaves the DNA sequence 5'-GGTNACC-3' (where N is any nucleotide). It is commonly used in molecular biology applications such as DNA cloning, restriction mapping, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Haeiii, by Thermo Fisher Scientific (2 mentions)
Pegfp c1 vector, by Takara Bio (2 mentions)
Taq pcr master mix kit, by Qiagen (1 mentions)
Pageblue, by Thermo Fisher Scientific (1 mentions)
Talon metal affinity resin, by Takara Bio (1 mentions)
Ecorv, by Thermo Fisher Scientific (1 mentions)
Ampicillin, by Thermo Fisher Scientific (1 mentions)
Hispeed plasmid maxi kit, by Qiagen (1 mentions)
Bamhi, by New England Biolabs (1 mentions)
Gibson assembly master mix, by New England Biolabs (1 mentions)
Transformaid bacterial transformation kit, by Thermo Fisher Scientific (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Gblock gene fragment, by Integrated DNA Technologies (1 mentions)
10 protocols using bsteii
1
CTLA-4 Polymorphism Genotyping
2
Recombinant VHH Purification from E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed on M13 plasmid using primers iVHH-FW (CGGAATTCCTTTAGTTGTTCCA), and iVHH-Rev (CACATCATCATCACCATCACG), or nVHH-FW (CGCTGGATTGTTATTACTCGC) and nVHH-Rev (CCTCAGAACCCAAGACCA). PCR fragments were cloned into pUR5850 [23 (link)] by SfiI and BstEII (Fermentas) digestion and ligation. Clones were verified by sequence analysis and transferred into Neb5 E. coli for production. VHH were purified using the His6-tag with TALON metal affinity resin (Clontech, Mountain View CA, USA) according to the manufacturer’s instructions using 50 mM NaPO4, 0.3 M NaCl, pH7 as wash buffer. Wash buffer with 150 mM imidazole was used as elution buffer. Pooled eluates were dialyzed against PBS using Cellu-Sep dialyze-tube MWCO 3500 (Interchim, MontluÇon, France). VHH production was checked on Coomassie staining (PageBlue, Thermo-Scientific) and western blotting against the VSV-tag. VHH was quantified with bicinchoninic assay (BCA, Thermo-Scientific). VHH were stored in 5 % glycerol at −20 °C.
3
Rapid Mycobacterial Identification via PCR-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the extraction of DNA a loopful of mycobacteria grown on 7H10 medium was suspended in 300 mL of TE buffer (10 mMTris, 1 mM EDTA pH 8.5) and subjected to 3 cycles of boiling (10 min. at 100°C) and freezing (20 minutes at -20°C). The PRA technique (PCR-Restriction Enzyme Analysis) was used to identify the mycobacterial isolates. A 439 bp fragment was amplified from the hsp65 gene for PCR. The DNA sequence of the PCR product was then digesting with the enzymes BstEII (Fermentas, Glen Burnie, MD, USA) and HaeIII (Fermentas, Glen Burnie, MD, USA) according to [21 ]. The products of the digestion reaction was separated and visualized by gel electrophoresis. The pattern of bands obtained was then compared with the banding patterns obtained from reference strains according to the database PRASITE (http://app.chuv.ch/prasite ).
4
Development of LRPAP1 IgG1 BAR body
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pSfi FLAG-Tag expression vector was used to assemble the sequence of the IgG1-format LRPAP1 BAR body (Supplemental Digital Figure 5, http://links.lww.com/HS/A179 ). The pSfi FLAG-Tag vector was generated from the pEGFP-C1 vector of Clontech (Mountain View, CA) by removing the eGFP ORF and replacing it with a FLAG-Tag. An IgG1 sequence comprising a heavy chain variable region, the heavy chain constant regions CH1-CH3, a furin cleavage site, an autoproteolytic 2A peptide sequence, a light chain variable and a constant region30 (link) was used as template. VH and VL were exchanged with the sequence of LRPAP1 that had been tested as Fab-format BAR body and selected for further experiments (Version A, amino acids 263–350) containing the MCL reactive epitope (amino acids 264–318). Primers and restriction sites used are listed in Table 3 . Restriction enzymes MunI and BstEII (ThermoFisher Scientific) were used to replace the VH region with the LRPAP1 fragment (amino acids 263–350) and AgeI and SmaI were used to integrate amino acids 263–350 of LRPAP1 into the VL region.
5
Genomic DNA Restriction Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Restriction digestions were prepared in 10 μl volume reaction containing ∼500 ng of genomic DNA, 1 μL of restriction enzyme: AanI, BcuI, BstEII, EcoRV, HaeIII or NsiI (ThermoFisher) and 1 μl of a 10× corresponding reaction buffer. Reactions were performed at 37°C for 1 h. Afterwards, DNA fragments were visualized on a 1% agarose gel using GelRed as the DNA dye in a loading buffer.
6
Constructing Chimeric HIV Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the chimeric virus, vector pNL4-3∆gag/PR was used as the backbone vector. This vector was constructed by the insertion of the specific restriction enzyme BstEII at the 5′ end of the gag gene, and at 45 bases downstream from the 3′ end of the PR gene using the QuikChange II Site-Directed Mutagenesis Kit site (Stratagene, La Jolla, CA, USA). The backbone vector was treated with BstEII (Thermo Scientific, Rockford, IL, USA) to remove the wild-type gag/PR and allow the vector to self-ligate. Then, the stock backbone vector was prepared by transformation into Top 10 Escherichia coli competent cells. The bacterial cells were spread on Luria–Bertani (LB) agar containing 100 µg/mL of ampicillin (Gibco). A Hi-Speed Plasmid Maxi Kit (Qiagen) was used to extract and purify the backbone vector [26 (link)].
7
Overexpression of GmDUF4228-70 in Soybean
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CDS of GmDUF4228-70 was amplified from Williams 82 cDNA with gene-specific primers containing restriction site sequences for NcoI and BsTEII. The PCR products and the pCAMBIA3301 vector were digested with NcoI and BsTEII (Thermo Fisher Scientific, United States), and the products were ligated to obtain pCAMBIA3301-GmDUF4228-70 (GmDUF4228-70-OE) lines (Kereszt et al., 2007 (link)).
8
Constructing pCAMBIA3301-GmCDPK3 and pCAMBIA3301-GmCDPK3i
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After amplification of the CDS of GmCDPK3, the restriction site sequences (NcoI and BsTEII) and gene-specific primers were ligated to the end of GmCDPK3. The PCR products and the pCAMBIA3301 vector were digested with NcoI and BsTEII (ThermoFisher Scientific, USA), respectively, and the product was ligated to obtain pCAMBIA3301-GmCDPK3 [44 (link),50 (link)]. The RNAi sequence was selected on the sense strand encoding the mRNA, the sense strand and the antisense strand of the selected interference sequence were inserted before and after the sequence, and the non-coding sequence (153 bp) from maize was inserted in the middle to form a large hairpin structure. The structure was clipped to cause the gene to be disturbed without expression. After selecting the sequence, it was submitted to the AUGCT company (Beijing, China) for synthesis and testing. The RNAi sequence and the pCAMBIA3301 vector were digested with NcoI and BsTEII, respectively, and the product was ligated to obtain pCAMBIA3301-GmCDPK3i.
9
Neurabin-I BAR-body IgG1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assemble the sequence the IgG1-format neurabin-I BAR-body a pSfi FLAG-Tag expression vector was used. The pSfi FLAG-Tag vector is derived from the pEGFP-C1 vector of Clontech (Mountain View, CA, USA) from which the eGFP ORF was removed and replaced by a FLAG-Tag. A pSfi-cloned IgG1 sequence consisting of a VH, the heavy chain constant regions CH1-CH3, a Furin + 2A sequence, a VL, and the light chain constant region (26 (link)) served as template. VH and VL were exchanged with a sequence of similar length (approximately 120 amino acids) of neurabin-I (aa 1168–1285) containing the PCNSL reactive epitope (aa 1226–1251). Primers used are listed in Table 2
10
Recombinant Expression of sdAb-SFP Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of the anti-MMR sdAb clone 1 and anti-β-lactamase sdAb (a.k.a. BCII10) was previously described [41] (link). The genes encoding for these sdAbs were recloned from the pHEN4 vector in the bacterial expression vector pHEN6 using restriction enzymes PstI and BstEII (Thermo Fisher Scientific). This vector was a kind gift of Steve Schoonooghe and contains a human immunoglobulin A (hIgA) based hinge (GSPSTPPTPSPSTPPASG) coupled to mWasabi (wasabi green, WG, Sequence from Addgene, the nonprofit plasmid repository). In addition, a haemagglutinin tag (YPYDVPDYA) for detection and HIS6 tag (HHHHHH) for immobilized metal affinity chromatography (IMAC) purification are present. To generate the tSMAC-SFPs, WG was removed from the pHEN6 vector and replaced with the gBlock® Gene fragment (Integrated DNA Technologies, Leuven, Belgium) encoding for tSMAC using the restriction enzymes EcoRI and BamHi (New England BioLabs, Leiden, The Netherlands) and the Gibson Assembly Master Mix (New England BioLabs). The resulting pHEN6 WG or tSMAC-SFP plasmids were transformed with the Transform Aid Bacterial Transformation Kit (Thermo Fisher Scientific) in E. coli WK6 cells allowing the selection of recombinant clones in the presence of 100 μg/mL ampicillin (S.A. Bristol-Myers Squib, Brussels, Belgium) enriched agar plates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!