HEK 293T cells were transfected with pAc‐PTCHD1‐GFP different plasmids using lipofectamine 2000 as described above. Two days after transfection total RNA was extracted from HEK 293T samples with TRIzol and then purified using a DirectZol Kit (Ozyme). About 1 µg of RNA was used to generate cDNA using a PrimeScript RT Reagent Kit (Takara, RR037B). PCR amplification of Ptchd1 cDNA was performed with a forward primer located in exon 1 is 5ʹ‐GCCAACATGCTAGACCAACA‐3ʹ, and the reverse primer located in exon 2 is 5ʹ‐CCCGAGCATTCTTTAGCTCTT‐3ʹ. The human GAPDH cDNA was used as a reference gene with a forward primer: (5ʹ‐CTGCACCACCAACTGCTTAG‐3ʹ) and a reverse primer (5ʹ‐GTCTTCTGGGTGGCAGTGAT‐3ʹ). PCR analyses were done in duplicates using SYBR Green Takyon Kit (Eurogentec, UF‐NSMT‐B0701) and a LightCycler 480 (Roche) on total cDNAs obtained from four independent cultures. Data were normalized to the GAPDH gene and to the pAc‐PTCHD1‐GFP WT control according to the 2−∆∆Cp method. Data statistical analysis was carried out with GraphPad Prism 8, using a Kruskal–Wallis test with Dunn's multiple comparisons from at least four independent experiments.
Takyon sybr green kit
Manufactured by Eurogentec
Sourced in Belgium
The Takyon SYBR green kit is a reagent solution designed for real-time quantitative PCR (RT-qPCR) analysis. It contains a SYBR green dye that binds to double-stranded DNA, allowing for the quantification of target DNA sequences. The kit provides the necessary components for performing RT-qPCR experiments, including the SYBR green master mix and appropriate controls.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (2 mentions)
Prism 8, by GraphPad (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Directzol kit, by Ozyme (1 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 device, by Roche (1 mentions)
Primer sequences, by Eurogentec (1 mentions)
5 protocols using takyon sybr green kit
1
Quantifying Ptchd1 Expression in HEK 293T Cells
2
RT-PCR and RT-qPCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RT-PCR, cDNAs were obtained using 200 ng of total RNA with the sensiFAST cDNA synthesis kit (Meridian Bioscience, Memphis, TN, USA). PCR was then performed with Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s protocol, and PCR products were observed on a TBE 1% agarose gel.
For RT-qPCR, total RNA extraction and cDNA synthesis were performed as described above. Real-time PCR was performed on 5 ng of cDNA using the SyBR green Takyon kit (Eurogentec, Seraing, Belgium UF-NSMT-B0701) in a Light Cycler 480 (Roche). Data were normalized to GAPDH and transfectant-only condition using the 2−∆∆Cp method. Primers used for human HECW1: GTTTTGTGTCCTTGCCCACT, GAATTGCAGCTGTCCACTCA; mouse Hecw1: ACTCCATAATTCCCAGCCAAT, AGCCTCCCAGTTTGGTGGA; GAPDH: CTGCACCACCAACTGCTTAG, GTCTTCTGGGTGGCAGTGAT.
For RT-qPCR, total RNA extraction and cDNA synthesis were performed as described above. Real-time PCR was performed on 5 ng of cDNA using the SyBR green Takyon kit (Eurogentec, Seraing, Belgium UF-NSMT-B0701) in a Light Cycler 480 (Roche). Data were normalized to GAPDH and transfectant-only condition using the 2−∆∆Cp method. Primers used for human HECW1: GTTTTGTGTCCTTGCCCACT, GAATTGCAGCTGTCCACTCA; mouse Hecw1: ACTCCATAATTCCCAGCCAAT, AGCCTCCCAGTTTGGTGGA; GAPDH: CTGCACCACCAACTGCTTAG, GTCTTCTGGGTGGCAGTGAT.
3
Generating Stable Cell Lines for Protease Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells stably expressing the protease reporter constructs were generated by lentiviral transduction. Subconfluent HEK-293T cells were transfected with the pWPI vector encoding the reporter construct together with packaging plasmids pCMV-Gag-Pol and pMD2-VSV-G (kind gifts from D. Trono, EPFL, Lausanne). After 2 days, the supernatant of the transfected cells was harvested, filtered, and stored at –80°C. Lentiviruses were titrated by SYBR green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay (46 (link), 47 (link)) using the Takyon SYBR green kit (Eurogentec). The titer was determined by comparison with a standard curve of known RNA concentrations. Lentiviral transduction was performed by addition of the filtered supernatant to Huh7, Huh7-Lunet-T7, or A549-ACE2 cells (multiplicity of infection [MOI] = 5) in the presence of 4 μg/ml of Polybrene. For the generation of stable cell lines expressing the reporter constructs, cells were cultured in medium containing 1 μg/ml puromycin. Cells stably expressing the SARS-CoV-2-optimized reporter construct were selected by fluorescence-activated cell sorting (FACS) to obtain single-cell clones with homogenous expression levels of the fluorescent reporter.
4
Quantitative SARS-CoV-2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or supernatants were resuspended in 1 mL of TriZol reagent (Life Technologies, Bleiswijk, The Netherlands). Total RNAs were isolated according to manufacturer’s instructions. RNA yield and purity were determined using a spectrophotometer NanoDrop 1000 (Thermo Scientific, Bleiswijk, The Netherlands). Total RNAs were reverse transcribed using the Super Script III Reverse Transcriptase kit according to manufacturer’s instructions (Invitrogen, Merelbeke, Belgium). cDNA samples were used to amplify SARS-CoV-2 gene E with Takyon TaqMan kit [33 (link)] and human genes of interest with Takyon SYBR Green kit (Eurogentec, Liège, Belgium) in a Light Cycler 96 device (Roche Diagnostics, Mannheim, Germany). Primer sequences (Eurogentec, Liège, Belgium) are listed in Table 1 . The relative gene expression was calculated using the ΔCq method with human hprt as housekeeping gene.
5
HCV Pseudoparticle Production and Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Immunodeficiency virus (HIV)-based particles bearing HCV envelope proteins were produced by HEK293T cells. 1.2x106 cells were seeded in a 6 cm-diameter-dish and transfected with 2.16 μg envelope protein expression construct pcDNAΔcE1E2-Con1 [72 (link)], pcDNAΔcE1E2-GLT1 or pcDNAΔcE1E2-GLT1cc, 6.42 μg HIV gag-pol expression construct pCMVΔ8.74 [73 (link)] and 6.42 μg firefly luciferase transducing retroviral vector [78 (link)] using polyethylenimine (PEI). Medium was replaced after 6 h. After 48 h, supernatant containing the pseudoparticles was passed through a 0.45 μm filter and used to infect 4x104 naïve Huh7-Lunet CD81 cells seeded in a 12-well plate the day before. After 72 h, luciferase assay was performed. SYBR Green based Product Enhanced Reverse Transcriptase assay (SG-PERT) was performed using the Takyon SYBR green kit (Eurogentec) to quantify HCVpp titers used for infection [79 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!