Taq dna polymerase recombinant kit

The amplification was performed using a commercial Taq DNA Polymerase recombinant Kit (Invitrogen, Thermo Fisher Scientific) for 35 cycles in a 2720 Thermal Cycler (Applied Biosystems, Carlsbad, CA, USA), using, as a template, cDNA coming for a pool of mussel ovaries that was previously synthesized in the framework of another project and stored at −80 °C. The thermocycler was programmed with the following steps: 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 50 °C (Tm) for 30 s, elongation at 72 °C for 8 s and finally, 72 °C for 8 min. PCR products were analyzed by electrophoresis in ethidium bromide-stained agarose gels (1.5%).
When the resulting amplicon was observed to be unique and displaying the expected molecular weight (411 bp), it was sent for sequencing to the Bank of DNA Service of the University of the Basque Country (SGIker sequencing service of UPV/EHU), using both the forward and reverse primers.

Reagents from Taq DNA Polymerase recombinant kit (Invitrogen, ThermoFisher, USA) were used to prepare the reaction mix. PCR was performed in a final volume of 25μl containing 2.5μl of 10X Taq polymerase buffer, 2 mM magnesium chloride, 0.8 mM dNTP Mix and 2.5 U of Taq DNA polymerase. PCR was amplified using the following cycling profile: one initial denaturation step at 95°C for 5 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and extension at 72°C for 30 s. The liver sample from clinical affected chickens confirmed positive by histological examination was used as a positive control whereas DNA extracted from SPF poultry liver was used as a negative control.

The presence of PrV was verified by nested PCR targeting the viral glycoprotein G (gG) gene using the following primer sets, whose reliability had been previously tested by Yoon et al. (2005) [26 (link)]: PRV_G_F1: ATGTTGTCGTTTGATCCCGTC; PRV_G_R1: AGCCGCGAGAGTAGTCCGTCC (product size 327 bp); PRV_G_F2: GAATGTGGACCGTATAAAACGGC; and PRV_G_R2: TGGCCGTAGCAGAGCTCC (product size 168 bp). The first PCR amplification was performed using 500 ng of genomic DNA and Taq DNA Polymerase Recombinant kit (Invitrogen) in a 25-µL reaction volume. The DNA was amplified in the Ep-Gradient Mastercycler (Eppendorf) with the following PCR conditions: after a first step of 95 °C for 10 min, DNA was subjected to 30 cycles of 94 °C for 45 s, 62 °C for 1 min, and 72 °C for 1 min, with a final extension of 72 °C for 10 min. A second nested PCR amplification was performed applying the same conditions and using 5 µL of the products of the first PCR.
A 2.0% agarose gel electrophoresis was performed to resolve the PCR products; then, the fragments of the expected size were purified using the E.Z.N.A Gel Extraction Kit (OMEGA), following the manufacturer’s protocol. DNA sequencing of the purified fragments was performed on the Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific), using the same primers used for amplification.