Total RNA was extracted from cells using RNeasy Mini Kit (Qiagen). cDNA was made by reverse-transcribing 1 μg of total RNA using MuLV Reverse Transcriptase and Oligo (dT) primers (Applied Biosystems). qRT-PCR was performed with a Bio-Rad CFX Detection System (Bio-Rad) and expression of target genes was measured using Power SYBR green PCR kit (Applied Biosystems). Samples were amplified in triplicate and relative gene expression was analyzed using Bio-Rad CFX manager software and normalized to 18S RNA. Primer sequences were used to measure the expression of reprogramming transcription factors, stem cell and neural lineage markers were previously reported by us.21 (link) Primer sequences used in this study were obtained from PrimerBank (https://pga.mgh.harvard.edu/primerbank/ ) and are listed in Supplementary Tables 1 and 2 .
Cfx detection system
Manufactured by Bio-Rad
Sourced in United States, Japan
The CFX detection system is a real-time PCR instrument designed for quantitative analysis of nucleic acid samples. It offers precise temperature control and reliable fluorescence detection capabilities to support various real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Iq sybr green supermix, by Bio-Rad (3 mentions)
Oligo dt primer, by Thermo Fisher Scientific (2 mentions)
Power sybr green pcr kit, by Thermo Fisher Scientific (2 mentions)
Mulv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
One step tb green primescript rt pcr kit, by Takara Bio (2 mentions)
Trizol, by Tiangen Biotech (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dnase and rnase free water, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Soadvanced sybr green supermix, by Bio-Rad (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Dna elution kit, by Qiagen (1 mentions)
Sybr green pcr reagent, by Bio-Rad (1 mentions)
Rnaeasy kit, by Qiagen (1 mentions)
First strand cdna synthesis kit, by Roche (1 mentions)
Poly 1 c, by Merck Group (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Cfx manager software version 3, by Bio-Rad (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
19 protocols using cfx detection system
1
Quantitative RT-PCR Analysis of Gene Expression
2
Total RNA Isolation and Analysis
3
Quantitative Viral DNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The main aim of molecular analysis was to determine the quantity of the specimen. In order to do so, viral DNA was extracted from all three specimens using QIAamp DNA Kit (Qiagene; Venlo, Limburg, The Netherlands). Extraction was performed in accordance with the guidelines and instructions provided by the manufacturer. The quantity of the samples was evaluated using a real-time PCR-specific assay kit (AJ Roboscreen GmbH/Analytik Jena GROUP; Leipzig, Germany) and the Bio Rad-CFX detection system (Bio-Rad Laboratories; Hercules, California, USA). The diagnostic kit used SYBR Green. Heat cycles were programmed as follows. First, national denaturation was set to 95°C for two minutes. Denaturation was also performed at 95°C, but for 30 seconds. Annealing was performed at 61°C for 45 seconds. Extension took place at 72°C for 30 seconds and final extension was carried out at 72°C for seven minutes. The aforementioned cycle was repeated 42 times (each cycle begins with denaturation and ends in extension). The confidence limit of the results of diagnostic kit was 95 percent. The amount of viral copies was expressed as an exponent of 10(e).
4
Quantifying Soil Microbial Diversity and Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From rhizosphere soil, DNA was extracted using the PowerSoil DNA Isolation Kit (QiagenR Valencia, CA, United States) following the manufacturer’s protocol. From bulk soil samples, RNA and DNA were co-extracted using RNeasy PowerSoilTM Total RNA Kit and DNA Elution Kit (Qiagen®, Valencia, CA, United States) following the manufacturer’s instructions. The RNA obtained was subjected to DNase treatment and then reverse transcribed to complementary DNA (cDNA) suitable for qPCR.
The total bacterial (16S rRNA) and fungal (18S rRNA) genes and transcripts from rhizosphere and bulk soil, respectively, were quantified by performing qPCR. Primer pairs 338F/518R (16S rRNA; Fierer et al., 2005 (link)) and FF390/FR1 (18S rRNA; Vainio and Hantula, 2000 (link)) were used for target genes and transcripts (further details provided withSupplementary Table 3 ). Samples were analyzed in duplicates in 96-well PCR plates with a Bio-Rad CFX detection system (Bio-Rad Laboratories, Inc., Hercules, CA, United States). The PCR efficiency, R2, and slope of the standard curve for quantification were 16S (101.9%, 0.99, and −3.27), 18S (99.2%, 0.98, and −3.34).
The total bacterial (16S rRNA) and fungal (18S rRNA) genes and transcripts from rhizosphere and bulk soil, respectively, were quantified by performing qPCR. Primer pairs 338F/518R (16S rRNA; Fierer et al., 2005 (link)) and FF390/FR1 (18S rRNA; Vainio and Hantula, 2000 (link)) were used for target genes and transcripts (further details provided with
5
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using RNeasy Mini Kit (Qiagen). cDNA was made by reversetranscribing 1 mg of total RNA using MuLV Reverse Transcriptase and Oligo (dT) primers (Applied Biosystems). qRT-PCR was performed with a Bio-Rad CFX detection System (Bio-Rad) and expression of target genes was measured using Power SYBR green PCR kit (Applied Biosystems). Samples were ampli ed in triplicate and relative gene expression was analyzed using Bio-Rad CFX manager software and normalized to 18S RNA. Primer sequences used to measure expression of reprogramming transcription factors, stem cell and neural lineage markers were previously reported by us 19 (link) . Primer sequences used in this study were obtained from PrimerBank (https://pga.mgh.harvard.edu/primerbank/) and are listed in table S1 andS2.
6
Quantitative PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was performed as previously described.39 (link) Briefly, total RNA was isolated from samples using RNAeasy kit (Qiagen). DNAse I (Thermo-Fisher)-treated RNA was used to generate cDNA by reverse transcription according to the manufacturer’s instructions (First Strand cDNA Synthesis Kit; Roche Applied Science). qPCR reactions were performed in a BioRad CFX detection system using SYBR green PCR reagents as described by the manufacturer. A calibration curve was performed for each primer pair, and all oligo-nucleotides were tested to ensure specificity and sensitivity. Ribosomal RNA (18S) was used as an endogenous control. The expression levels of the target genes in each sample were calculated by normalizing the mRNA level of a particular gene against 18S ribosomal RNA, which is considered a stable housekeeping gene. The following oligonucleotide primer pairs were used:
| 18S | Forward: 5′ AGTCCCTGCCCTTTGTACACA |
| Reverse: 5′ CGATCCGAGGGCCTCACTA | |
| Alkaline phosphatase(ALP) | Forward: 5′ ACTGATGTGGAATACGAACTGGATGAGAAGG |
| Reverse: 5′ CAGTCAGGTTGTTCCGATTCAATTCATACTGC | |
| Collagen type I | Forward: 5′ AACCTGGTGCGAAAGGTGAA |
| Reverse: 5′ AGGAGCACCAACGTTACCAA | |
| Osteocalcin (OCN) | Forward: 5′ TCTCTCTGACCTC ACAGATGCCAAGC |
| Reverse: 5′ GGACTGAGGCTCCAA GGTAGCG | |
| β-Actin | Forward: 5′ TCACCCACACTGTG CCCATCTACGA |
| Reverse: 5′ CAGCGGAACCGCTC ATTGCCAATGG. |
7
Validation of qPCR Targets for Animal Fecal DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
See S1
Table for a list of gene targets used in this study. For all qPCR
studies, a standard curve serial dilution for the respective target was run in
replicate on all plates for validation purposes. A run was considered valid only
if the BioRad CFX Detection System detected an efficiency of 90–110% and a
correlation r2 > 0.98. Both experimental (i.e. infected animal
fecal DNA) and controls (i.e. uninfected animal fecal DNA) were run on the
plate. A non-template control was universally included on every plate to control
for non-specific amplifications.
Table
studies, a standard curve serial dilution for the respective target was run in
replicate on all plates for validation purposes. A run was considered valid only
if the BioRad CFX Detection System detected an efficiency of 90–110% and a
correlation r2 > 0.98. Both experimental (i.e. infected animal
fecal DNA) and controls (i.e. uninfected animal fecal DNA) were run on the
plate. A non-template control was universally included on every plate to control
for non-specific amplifications.
8
siRNA-mediated Silencing of G3BP2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA targeting G3BP2 was purchased from Thermo Fisher. 16HBE and A549 cells were seeded into a 12-well plate at 2 × 105 cells per well and transfected with 30 pg siRNA; cell samples were collected after 48 h. Total RNA was extracted with TRIzol (TIANGEN, Beijing, China), and a One-Step TB Green ®PrimeScript RT–PCR Kit (TAKARA, Tokyo, Japan) and Bio-rad CFX Detection System was used for RT–PCR.
9
SARS-CoV-2 Infection and Poly(I:C) Induction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
16HBE and A549 cells were seeded into a 12-well plate at 2 × 105 cells per well and infected with SARS-CoV-2 virus (MOI = 0.5) or transfected with poly (I:C) (Sigma–Aldrich, St. Louis, MO, USA). The cell samples were collected after 0, 3, 6 and 24 h, and the total RNA of cell samples were extracted with TRIzol (TIANGEN, Beijing, China). One-Step TB Green ®PrimeScript RT–PCR Kit (TAKARA, Tokyo, Japan) and Bio-rad CFX Detection System were used for RT–PCR. The transcription levels of target genes were quantified by the 2−ΔΔct [25 (link)]. The results were normalized to GAPDH expression.
10
Quantifying ANDV RNA in Hamster Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung specimens were obtained from all golden hamsters following standard necropsy protocols. Total RNA was extracted from lung specimens using TRIzol, as described previously (45 (link)). RT-qPCR using ANDV genomic small (S) segment primers was performed following published procedures (46 (link)). Two microliters of each RNA sample were amplified in duplicate assays with a CFX detection system (Bio-Rad, Hercules, CA, USA), using TaqMan RT-PCR master mix (Quanta Biosciences, Gaithersburg, MD, USA), according to the manufacturers’ instructions. A primer set designed to detect the human RNase P gene was used to ensure that samples were free of PCR inhibitors and that RNA extractions were homogeneous.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!