Qiaprep spin plasmid kit

Manufactured by Qiagen

Sourced in Germany

The QIAprep-Spin plasmid kit is a laboratory product designed for the rapid and efficient purification of plasmid DNA from bacterial cultures. It utilizes a silica-membrane technology to isolate plasmid DNA from cell lysates.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

QIAprep kit (30 citations) QIAprep Spin kit (21 citations) QIAprep (15 citations) Plasmid kits (15 citations) Qiapreps spin plasmid kit (2 citations) QIAprep Spin Plasmid Mini-prep kits (2 citations)

3 protocols using qiaprep spin plasmid kit

Establishment of Stable CHO Cell Line Expressing ARMS1-PK2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The oligonucleotides used in this study were synthesized by Genotech (Daejeon,
Korea). The cloning vector (pGEMT-T easy) was purchased from Promega (Madison,
WI, USA). The pcDNA3 expression vector, pCMV-ARMS1-PK2 expression vector,
Freestyle MAX reagent, FreeStyle CHO-suspension (CHO-S) cells and AssayComplete
medium were purchased from Invitrogen (Carlsbad, CA, USA). The PathHunter
Parental CHO-K1 cell line expressing β-arrestin 2 was
purchased from DiscoveRx (San Diego, CA, USA). The pCORON1000 SP VSV-G-tag
expression vector was purchased from Amersham Biosciences (Piscataway, NJ, USA).
The PMSG-ELISA kit was purchased from DRG International (Mountainside, NJ, USA).
Restriction enzymes and DNA ligation reagents were purchased from Takara Bio
(Shiga, Japan). Fetal bovine serum (FBS) was obtained from HyClone Laboratories
(Logan, UT, USA). The cAMP Dynamic 2 immunoassay kit was purchased from Cisbio
(Codolet, France). CHO-K1 cells and HEK 293 cells were obtained from the Korean
Cell Line Bank (KCLB, Seoul, Korea). The QIAprep-Spin plasmid kit was purchased
from Qiagen (Hilden, Germany). All other reagents were obtained from
Sigma-Aldrich (St. Louis, MO, USA).

Byambaragchaa M., Joo H.E., Kim S.G., Kim Y.J., Park G.E, & Min K.S. (2022). Signal Transduction of C-Terminal Phosphorylation Regions for Equine Luteinizing Hormone/Chorionic Gonadotropin Receptor (eLH/CGR). Development & Reproduction, 26(1), 1-12.

+ Open protocol

+ Expand

RAPD Marker Cloning and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

A selection of 65 differentially amplified bands among the 12 DNAs panel were cut from agarose gels, and purified using the Qiaquick Gel extraction kit (Qiagen, Hilden, Germany) according to the protocol provided by the supplier. In some instances, the bands were re-amplified using the corresponding RAPD primers before the purification step. The bands were cloned into the plasmid vector provided in the pMOSBlue Blunt Ended Cloning Kit (HVD-Amersham, Athens, Greece) following the manufacturer instructions. PCR colony using plasmid primers and agarose gel electrophoresis allowed screening for inserts having the same size than those aimed for the cloning. Only 22 bands generated with 9 RAPD markers were successfully cloned. Analysis of recombinant plasmids was performed by extracting plasmid DNA from small volume cultures grown overnight at 37°C by using the Qiaprep Spin plasmid kit (Qiagen, Hilden, Germany). Sequencing of RAPD markers was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (HVD-Amersham, Athens, Greece) using the T7 (5′ CTAATACGACTCACTATAGGG 3′) and U19 (5′ TTTTCCCAGTCACGACGT 3′) primers located on the plasmid. The automated sequencer ABI PRISM 3130 Genetic 177 Analyzer (Applied Biosystem, Foster City, CA, USA) was used to generate the electrophoregrams.

Mkada–Driss I., Lahmadi R., Chakroun A.S., Talbi C., Guerbouj S., Driss M., Elamine E.M., Cupolillo E., Mukhtar M.M, & Guizani I. (2014). Screening and Characterization of RAPD Markers in Viscerotropic Leishmania Parasites. PLoS ONE, 9(10), e109773.

+ Open protocol

+ Expand

Recombinant Protein Expression in CHO Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pcDNA3 mammalian expressing vector, Chinese hamster ovary suspension (CHO-S)
cells, FreeStyle MAX reagent, and FreeStyle CHO expression medium, were
purchased from Invitrogen (San Diego, CA, USA). CHO-K1 cells were obtained from
the Korean Cell Bank (KCB) (Seoul, Korea). The polymerase chain reaction (PCR)
reagents, restriction enzymes, and DNA ligation kits were obtained from Takara
(Shiga, Japan). Ham’s F-12 medium, Opti-MEM I, serum-free CHO-S-SFM II,
and Lipofectamine 2000 were purchased from Gibco BRL (Grand Island, NY, USA).
Fetal bovine serum (FBS) was obtained from Hyclone Laboratories (Logan, UT,
USA). Disposable spinner flasks and glass flasks were obtained from Corning
(Corning, NY, USA). The cyclic adenosine monophosphate (cAMP) Dynamic 2
immunoassay kit was purchased from Cisbio Bioassay (Codolet, France). PSMG
enzyme-linked immunosorbent assay (ELISA) kit was purchased from DRG
International (Mountainside, NJ, USA). The QIAprep-Spin plasmid kit was
purchased from Qiagen (Hilden, Germany). The oligonucleotides were synthesized
by Genotech (Daejeon, Korea). All other reagents were obtained from
Sigma-Aldrich (St. Louis, MO, USA).

Byambaragchaa M., Choi S.H., Joo H.E., Kim S.G., Kim Y.J., Park G.E., Kang M.H, & Min K.S. (2021). Specific Biological Activity of Equine Chorionic Gonadotropin (eCG) Glycosylation Sites in Cells Expressing Equine Luteinizing Hormone/CG (eLH/CG) Receptor. Development & Reproduction, 25(4), 199-211.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!