Prism 7000 real time pcr system

Total RNA was extracted using TRIzol reagent (Invitrogen, CA, U.S.). Reverse transcription of cDNA was carried out using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, CA, U.S.). Gene-specific PCR amplification was performed with Power SYBR Green Master Mix on a Prism 7000 Real-Time PCR System (all from Applied Biosystems, CA, U.S.). Relative gene expression was calculated with the 2^−ΔΔCt method after normalization to GAPDH expression. Primers for HIF-1α, vascular cell adhesion molecule-1 (VCAM-1), stromal cell-derived factor-1 (SDF-1), and insulin-like growth factor-1 (IGF-1), are listed in the Supplementary Table S1.

Total RNA from cells or tissues was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. In order to detect the mRNA level, PrimeScript™ RT reagent Kit (Takara, Japan) was used to transcribe 200 ng RNA to cDNA synthesis. Prism 7000 Real-Time PCR system (Applied Biosystems, USA) with SYBR Premix Ex Taq™ (TaKaRa, Shiga, Japan) were performed to measure the expressions of miR-181a-5p and SIRT1. GAPDH and U6 were performed as the internal controls. The cycle amplification conditions were as follows: 35 cycles of denaturing at 95˚C for 15sec, annealing at 60˚C for 60sec, chain extension step at 72˚C for 60sec and the final extension at 72˚C for 10 min. Primers were purchased from Sangon Biotech (Shanghai, China) and listed as following:
U6-forward, 5’GCTTCGGCAGCACATATACTAAAAT3’
reverse, 5’CGCTTCACGAATTTGCGTGTCAT3’;
GAPDH-forward, 5’CTTTGGTATCGTGGAAGGACTC3’;
reverse, 5’GTAGAGGCAGGGATGATGTTCT3’;
SIRT1-forward, 5’AATCCAGTCATTAAAGGTCTACAA3’;
reverse, 5’TAGGACCATTACTGCCAGAGG3’;
miR-181a-5p-forward, 5’CCGCGAACATTCAACGCTGTCG3’;
reverse, 5’ATCCAGTGCAGGGTCCGAGG-3’. The relative expression of target gene were calculated by relative quantification (2^−ΔΔCt) method (25 (link)).