RNA was extracted from one M4complete isolate and one M4degraded isolate cultured exponentially for 3 h using a using a hot acidic phenol method, as described previously [7 (link)]. RNA samples were then DNase treated with Turbo DNase-free (Ambion) for 30 min at 37 °C, and 5 µg was converted to cDNA by reverse transcription using Transcriptor reverse transcriptase (Roche) and random hexaoligos (Sigma-Aldrich). A corresponding RT-negative reaction was also performed for each sample, whereby the reverse transcriptase was excluded as a control for contaminating genomic DNA. Transcription of mutL and mutS was detected using standard PCR with 100 ng cDNA (or RT-negative equivalent) and primers designed to detect each transcript individually (Table S3).
Turbo dnase free
Manufactured by Thermo Fisher Scientific
Sourced in United States
Turbo DNase-free is a laboratory equipment designed to remove DNA from RNA samples. It functions by degrading DNA present in the sample, allowing for the isolation of pure RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Trizol ls, by Thermo Fisher Scientific (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Transcriptor reverse transcriptase, by Roche (1 mentions)
Genelute mammalian total rna miniprep kit, by Merck Group (1 mentions)
Taq polymerase, by New England Biolabs (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Qubit 2, by Thermo Fisher Scientific (1 mentions)
Maxima sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Thermostable α amylase, by Megazyme (1 mentions)
Nanodrop, by Bio-Rad (1 mentions)
Abi quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Onestep rt pcr kit, by Qiagen (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
18 protocols using turbo dnase free
1
Transcription of DNA Repair Genes
2
HIV Tat Exon Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TR146, FaDu, A431 and TZM-bl cells were seeded at 5 x 105 cells per well and the following day incubated with YU2 (R5) or LAI (X4) virus at an MOI of 0.2. After overnight incubation at 37°C unbound virus was removed by washing and total RNA isolated (GenElute Mammalian Total RNA Miniprep Kit; Sigma). Genomic DNA was removed with Turbo DNAse free (Ambion) according to the manufacturer's instructions and samples were confirmed DNA free prior to analysis. Equal amounts of total RNA was used to synthesize viral cDNA transcripts using the HIV-specific oligo ART-7 5′- TTC TAT TCC TTC GGG CCT GTC G -3′. A 1 µL aliquot of cDNA was then subjected to PCR using primers spanning the tat1 and 2 exon junctions (tat-junction forward: 5′- TAG ATC CTA GAC TAG AGC CC-3′ and tat-junction reverse 5′- TTG GGA GGT GGG TCT GAA ACG-3′ ) in a 20 µL reaction containing 1x PCR buffer, 100 µM dNTP's, 1.5 mM MgSO4, 2.5 U Taq polymerase (New England Biolabs) and 10 pmol of each primer. Cycle parameters were as follows: 95°C for 5 min; followed by 94°C for 10 s, 55°C for 30 s, and 72°C for 1 min for 35 cycles; with a final extension of 72°C for 10 min. PCR products were resolved on a 2% agarose gel and visualized by ethidium bromide staining.
3
Spermatozoa RNA Isolation and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated as described earlier22 (link). In brief, the spermatozoon samples (30–40 × 106 cells) were homogenized and lysed with a lysis buffer cocktail (0.5 mL of lysis buffer from the kit + 0.5 mL of TRIzol), followed by phase separation with 0.2 mL of chloroform. The remaining protocol was performed following the manufacturer’s instructions (PureLink RNA mini kit, Ambion, USA). The isolated RNA was treated with DNase (TURBO DNase free, Ambion, USA) to eliminate traces of gDNA. Total RNA was quantified using a fluorometer (Qubit 2.0, Invitrogen, USA) with an RNA high-sensitivity assay kit (Invitrogen, USA), and RNA quality was analyzed using a spectrophotometer to check for contamination from proteins and organic solvents. The Bioanalyzer system was used to assess the fragment size distribution of spermatozoal RNA. After quality and quantity analyses, total RNA samples were converted into cDNA using Superscript II (Invitrogen, USA). qPCR experiments were carried out to check for contamination with an input RNA concentration of 10 ng/reaction using cell-specific primers for RNA from other cell types and intron-spanning primers to detect spermatozoal gDNA contamination (Supplemental Table S7 ). The qPCR analyses were performed based on SYBR Green chemistry (MAXIMA SYBR Green Master Mix, Fermentas, USA).
4
RNA Extraction and qPCR Analysis of Whole Grains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from samples comprising two whole grains using the Sigma-Aldrich Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St Louis, MO) with the addition of a 6-min incubation with thermostable α-amylase (Megazyme, Wicklow, Ireland) in lysis buffer at room temperature prior to addition of β-mercaptoethanol (Betts et al., 2017 (link)). Following treatment with TURBO DNase-free (Ambion, Life Technologies, Waltham MA), cDNA synthesis was performed using SuperScript®III Reverse Transcriptase according to manufacturer's instructions (Life Technologies, Waltham, MA). Details of gene names, MLOCs and primer details are presented in Table S1 . QPCR primers were designed using Primer 3 software (Koressaar and Remm, 2007 (link)) and selected based on specificity as determined by blastn software (Table S1 ; Acland et al., 2013 (link)). qPCR was performed as described by Burton et al. (2008 (link)) with data normalised using the reference genes HvCyclophilin, HvGAPdH2, HvHSP70, and HvTubulin (Vandesompele et al., 2002 (link)).
5
Total RNA Extraction with TRIzol LS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using 750 ul TRIzol LS (Invitrogen) following the manufacturer’s protocol. Possible DNA contamination was eliminated by treating the RNA samples with TURBO DNAse-free (Ambion). The concentration of the RNA samples was evaluated by Qubit (Thermo Fisher), and then the samples were used for subsequent applications.
6
RNA Extraction with Small RNA Retention
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the Trizol samples with a modified Purelink RNA mini kit (Life Technologies) protocol which ensures retention of the small RNA fraction by adding an equal volume of 100% EtOH to the aqueous phase prior to addition onto the filter column. RNA was DNase I treated prior to sequencing using Turbo DNase-free (Ambion). RNA quantity and quality were assessed by Nanodrop and Experion bioanalyser chip (BioRad).
7
Estimating Transcript Abundance via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transcript abundance was estimated by real-time RT-PCR analysis as described by Ondzighi-Assoume [72 (link)] with few modifications. Total RNA was isolated from leaf, stem and root tissues harvested from 2-month-old transgenic and non-transgenic P32 and P605 plants. The isolation of RNA was performed using the Qiagen RNeasy Plant Mini Kit (Qiagen) and subsequently treated with Turbo DNase-free (Ambion) to remove genomic DNA contamination, and then subject to quantitative PCR with the ABI QuantStudio6 Flex Real-time PCR system (Applied Biosystems, ThermoFisher Scientific). Data were collected and analyzed according to the ΔΔCT method and normalized to the geometric mean of the expression of two housekeeping genes, P. virgatum L. ACTIN2 (PvACT) and P. virgatum L. UBIQUITIN (PvUBQ) [65 (link)] with the Quanta Studio™ 6 and 7 Flex System Software. Nucleotide sequences of primers used are listed in the Additional file 8 : Table S2.
8
Kidney Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were extracted from kidneys using miRNeasy kits (Qiagen), treated with Turbo DNase Free (Ambion) and quantified using NanoDrop ND-1000 spectrophotometer. The gene expression levels were assessed at 5, 16 and 21 weeks of age ± salt challenge by Taqman assays. FAM-labelled TaqMan probes for Dnm1 (Rn00589865_m1), Tor1b (Rn01439013_m1) and Rabgap1 (Rn00525120_m1) were duplexed with β-actin (4352340E; VIC-labelled), when appropriate. Expression of genes normalized to expression of β-actin in each sample was derived using the comparative (ΔΔCT) method, with salt-challenged 21-week-old SHRSP as calibrator strain, and expressed as fold-changes.
9
Quantitative RT-PCR of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples extracted with Trizol® (Life Technologies) were treated with Turbo DNase free (Ambion). Absence of genomic DNA was evaluated by RT-PCR using the One Step RT-PCR kit (Qiagen) and 18S rRNA-specific primers. For qRT-PCR, cDNA was synthetized from 1.5 μg total RNA with Oligo-dT primers (Invitrogen, Thermo Fischer Scientific) and StrataScript reverse transcriptase (Stratagene). RNA samples were diluted into 40 μl and 10 μl of a mix composed of 0.6 μl of Oligo-dT (500 ng/ml) and 9.4 μl of distilled water were added. Samples were incubated for 5 min at 65 °C and for 10 min at room temperature. A master mix (8.5 μl) containing 5 μl of StrataScript RT buffer, 1 μl of RNase inhibitor (40 U/μl), 2 μl of dNTPs (10 mM), and 0.5 μl of RT StrataScript enzyme was added and samples were incubated at 42 °C for 1 h. Three biological replicates each with three technical repetitions were tested for each virus/gene combination, using the primers listed in Table 1 . PCR efficiency was calculated from standard curves obtained using serial dilutions of tomato genomic DNA. The relative expression level of each gene was determined by the Pfaffl method, using UBC (SGN-U582847) as HK gene. The stability of UBC expression in the different infection condition was verified by ANOVA, using all the Mean Threshold Cycle (Ct) values from three plants, with three technical replicates each.
10
Drosophila RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 adult flies per biological replicate were homogenised in TRIzol and RNA extraction was carried out using Direct-zol RNA MiniPrep kit (Zymo Research, Z2050). DNA was removed with Turbo DNase free (Ambion, AM1907), and cDNA synthesis was performed using a Maxima First Strand kit (ThermoFisher, K1641) followed by a qRT-PCR using SYBR green (ThermoFisher, 4,309,155) with a CFX96 Touch Real-Time PCR Detection System. The relative transcript levels of each target gene were normalised against RpL32 and Tubulin (Tub84B) mRNA levels; quantification was performed using the comparative CT method [37 (link)]. Primers used:
Tubulin - Fwd: TGGGCCCGTCTGGACCACAA; Rev: TCGCCGTCACCGGAGTCCAT [38 (link)],
RPL32 - Fwd: GCCGCTTCAAGGGACAGTATCTG; Rev: AAACGCGGTTCTGCATGAG [39 (link)],
Pink1 - Fwd: AACAGTCCGGAGATCCTACAG; Rev: GACGACCCTCGCACATAA [40 (link)], and.
Parkin - Fwd: AGTACACCGTGGACCCAAAT; Rev: TGTGCTGACTTTGATGGTGA [40 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!