The largest database of trusted experimental protocols

Yeast rnaiso reagent kit

Manufactured by Takara Bio
Sourced in Japan

The Yeast RNAiso reagent kit is a solution for isolating and purifying total RNA from yeast samples. It is designed to provide high-quality, intact RNA for various downstream applications, such as gene expression analysis and reverse transcription. The kit utilizes a guanidinium thiocyanate-based extraction method to efficiently lyse cells and denature RNases, ensuring the preservation of RNA integrity.

Automatically generated - may contain errors

2 protocols using yeast rnaiso reagent kit

1

Quantifying Antifungal Drug Resistance in Candida using qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The qRT-PCR analysis was performed as described previously (21 (link)), with minor modifications. Isolates were incubated without any drug or with PG alone, FLC alone, or PG+FLC at synergistic concentrations at 37°C overnight. The suspensions were adjusted to 5 × 107 cells/ml in PBS, and the supernatants were collected after centrifugation at 3,000 × g. Total RNA was isolated using a yeast RNAiso reagent kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. RT-PCR was performed using RevertAid first-strand cDNA synthesis kits (Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCRs for CgCDR1, CgCDR2, and CgPDR1 were run in triplicate using SYBR green real-time PCR master mix kits (Toyobo, Osaka, Japan) in an ABI 7500 real-time fluorescent quantitative PCR system (Applied Biosystems, Foster City, CA, USA). The primers used in this study are listed in Table 4. Each qRT-PCR mixture (25 μl) contained 12.5 μl SYBR green real-time PCR master mix, 9.5 μl double-distilled water, 2 μl each primer, and 1 μl cDNA. PCR conditions were as follows: initial denaturation at 95°C for 1 min, followed by 40 cycles of 15 s at 95°C, 15 s at 60°C, and 45 s at 72°C. Target gene expression was quantified using the 2–ΔΔCT method, with ACT1 as a control (39 (link)).
+ Open protocol
+ Expand
2

Quantitative Analysis of Drug Resistance Genes in Candida

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from isolates grown to the mid-exponential phase in YPD medium with the Yeast RNAiso Reagent Kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. Quantitative real-time–PCR of CgCDR1, CgCDR2, CgSNQ2, CgPDR1, and CgERG11 was performed with the SYBR Premix Ex Taq Kit (TaKaRa) and LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland), as described previously.22 (link) All reactions were performed as follows: denaturation at 95 °C for 1 min, followed by 40 cycles that consisted of 15 s at 95 °C and 60 s at 60 °C. The primers used in the real-time RT–PCR are shown in Table 1. Quantification of each target gene was performed by the 2-△△CT method using the housekeeping gene ACT1 as a control.23 (link) Each reaction was performed in triplicate.

Primers used for real-time PCR

GeneNucleotide sequence (5′-3′)
CgCDR1F: ACACCAACAACAGCATCT
R: ATTCTCCGCTTACCTACG
CgCDR2F: CAACGCTATGAGGGAAAA
R: AACATAAGTGGCGTGGGT
CgSNQ2F: ACCATGTGTTCTGAATCAATCAAT
R: TCGACATCATTACAATACCAGAAA
CgERG11F: TGGAAGCAGTGAAGATAGT
R: AGTGTTCGGTAAAGGTGT
CgPDR1F: AGCCTTGCCGATAGTCATAC
R: AAGGTCAGGGCATACTTCAG
ACT1F: AGAAGTTGCTGCTTTAGTT
R: GACAGCTTGAATGGAAAC
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!