Maxima h minus first strand cdna synthesis

To estimate the population diversity of variants by deep sequencing, Coxsackie virus cDNA libraries were performed using the kit Maxima H Minus First Strand cDNA Synthesis (Thermofisher) and oligo dT as a primer from RNA extracted from virus generated in HeLa cells or different mouse organs. The viral genome was amplified using a high-fidelity polymerase (Phusion) to generate 1 amplicon of 7.2 kb in length (full-length genome). The primers and PCR were designed and optimized in the laboratory (5′ GAAAACGCGGGGAGGGTCAAA3′ and 5′ ACCCCCTCCCCCAACTGTAA 3′). For influenza A virus, the viral RNA genome was extracted from infected-cell supernatants (Macherey-Nagel), reverse-transcribed with an Accuscript High Fidelity 1st strand cDNA Synthesis kit (Agilent) using 5′-AGCRAAAGCAGG-3′ primer and amplified by PCR using a high-fidelity polymerase (Phusion). Eight PCRs were designed to cover the coding regions of the eight genomic segments (primer sequences are available upon request). For mouse organs, RNA was extracted with TRIzol reagent (Invitrogen) and PA and HA segments were targeted by PCR. The PCR products were purified and fragmented (Fragmentase), multiplexed, clustered on cBot for sequencing in GAIIX, or clustered and sequenced on NextSeq500, Illumina technology and analysed with established deep-sequencing data analysis tools and in-house scripts.