Following FANS, nuclei were washed twice in staining buffer before being re-suspended in 22 μl PBS and quantified. Nuclei concentrations were normalized and equal amounts from each sample were pooled together. 2 aliquots of 60,000 pooled nuclei (i.e. 10,000 each) were processed in parallel using 3’ v3.1 reagents (10x Genomics). At the cDNA amplification step (step 2.2), reactions were supplemented with a hash-tag oligo (HTO) cDNA “additive” primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T; *Phosphorothioate bond). Following cDNA amplification, supernatants from the 0.6x SPRI (Beckman Coulter) selection step were retained for HTO library generation. Otherwise, cDNA libraries were prepared according to the manufacturer’s instructions (10x Genomics). HTO libraries were prepared as described previously 56 (link). All libraries were sequenced at NYGC using the Novaseq platform (Illumina).
3 v3.1 reagents
Manufactured by 10x Genomics
The 3' v3.1 reagents are a set of laboratory equipment designed for use with 10x Genomics' microfluidic technology. The reagents enable the preparation of samples for single-cell RNA sequencing analysis.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using 3 v3.1 reagents
1
Single-cell RNA-seq with Unique Molecular Identifiers
2
Single-cell RNA-seq with Unique Molecular Identifiers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following FANS, nuclei were washed twice in staining buffer before being re-suspended in 22 μl PBS and quantified. Nuclei concentrations were normalized and equal amounts from each sample were pooled together. 2 aliquots of 60,000 pooled nuclei (i.e. 10,000 each) were processed in parallel using 3’ v3.1 reagents (10x Genomics). At the cDNA amplification step (step 2.2), reactions were supplemented with a hash-tag oligo (HTO) cDNA “additive” primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T; *Phosphorothioate bond). Following cDNA amplification, supernatants from the 0.6x SPRI (Beckman Coulter) selection step were retained for HTO library generation. Otherwise, cDNA libraries were prepared according to the manufacturer’s instructions (10x Genomics). HTO libraries were prepared as described previously 56 (link). All libraries were sequenced at NYGC using the Novaseq platform (Illumina).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!