The two PAO1 gDNA libraries (in pUT18 and pUT18C) were independently tested against bait proteins (in pKT25 or pKNT25). 50–100 ng of library DNA and 50 ng of plasmid bait were introduced together into BTH101 and plated onto MacConkey agar with 100 μg ml−1 ampicillin and 50 μg ml−1 kanamycin. Red colonies were re-streaked onto MacConkey agar. Colonies that remained red after re-plating were then grown overnight in LB broth with both antibiotics and plasmids were isolated using a Zyppy plasmid miniprep kit (Zymo Research, Irvine, CA). The plasmid mix was used to retransform BTH101 and plated onto LB Amp. Colonies were then streaked onto LB with 100 μg ml−1 ampicillin and onto LB with 50 μg ml−1 kanamycin to identify transformants that were AmpR but KanS (i.e., contained only the pUT18 or pUT18C plasmid). The pUT18 or pUT18C plasmid was then isolated and retested for interaction with the bait plasmid and against empty vector. Positive interactions were identified as red colonies on MacConkey agar after 48 h incubation at 30 °C. Plasmids were then sequenced to identify the cloned gene/s. Identified genes were then cloned in their entirety into the pUT18 and pUT18C plasmids and retested for protein interaction against the bait.
Zyppy plasmid miniprep kit
Manufactured by Zymo Research
Sourced in United States, Germany, Switzerland
The Zyppy Plasmid Miniprep Kit is a laboratory product designed for the rapid and efficient isolation of plasmid DNA from bacterial cultures. The kit utilizes a proprietary buffer system to lyse cells and bind plasmid DNA to a silica-based column, allowing for purification and concentration of the plasmid DNA sample.
Automatically generated - may contain errors
Lab products found in correlation
Zymoclean gel dna recovery kit, by Zymo Research (14 mentions)
Qiaquick pcr purification kit, by Qiagen (7 mentions)
Opti mem, by Thermo Fisher Scientific (6 mentions)
Illustra gfx pcr dna and gel band purification kit, by GE Healthcare (5 mentions)
Ta cloning kit, by Thermo Fisher Scientific (4 mentions)
T4 ligase, by New England Biolabs (4 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
T4 dna ligase, by Thermo Fisher Scientific (4 mentions)
T4 dna ligase, by New England Biolabs (3 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
Taq dna polymerase, by New England Biolabs (3 mentions)
Q5 hotstart start high fidelity 2x master mix, by New England Biolabs (3 mentions)
Zymopure 2 plasmid maxiprep kit, by Zymo Research (3 mentions)
Zymo jm109 chemically competent e coli, by Zymo Research (3 mentions)
Gblock, by Integrated DNA Technologies (3 mentions)
Quick dna miniprep kit, by Zymo Research (2 mentions)
Dna clean concentrator, by Zymo Research (2 mentions)
Cpgenome universal dna modification kit, by Merck Group (2 mentions)
86 protocols using zyppy plasmid miniprep kit
1
Bacterial Two-Hybrid Screening for Protein Interactions
2
Genomic Characterization of alh-6 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 200 adult worms were collected and washed with M9. Animals were homogenized and genomic DNA was extracted using the Zymo Research Quick-DNA Miniprep kit (Cat. #D3025). The entire alh-6 genomic sequence (ATG to stop) was amplified by PCR and cloned in a linearized pMiniT 2.0 vector (NEB PCR Cloning Kit, Cat. #E1202S). Plasmid DNA was purified using the Zymo Research Zyppy Plasmid Miniprep kit (Cat. D4019) and sequenced.
3
Bacterial DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of bacterial genomic DNA and plasmid DNA were conducted using the E.Z.N.A. bacterial DNA kit (Omega Bio-Tek, Norcross, GA, USA) and the Zyppy™ Plasmid Miniprep kit (Zymo Research, Freiburg, Germany), respectively, according to the manufacturer’s protocols. All PCR reactions were performed in a final volume of 50 μL containing 1× Buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 15 pmol of each forward and reverse primers and 0.02 U/µL KOD Hot Start DNA Polymerase (Novagen, WI, USA). PCR products or gel bands were purified with the DNA Clean & Concentrator or ZymocleanTM Gel DNA Recovery kits (Zymo Research, Freiburg, Germany). Unless otherwise specified, molecular techniques were performed using standard protocols [82 ]. The primers used in this study are listed in Table 2 .
4
Quantitative PCR Standards for Mycoplasma iowae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from a 50-mL culture using the QIAamp® DNA Mini Kit (QIAGEN). To improve quantification, plasmids were constructed that contained a copy of each gene target. Plasmids were constructed from PCR products amplified from M. iowae genomic DNA using gene-specific primers (Table 2 ) that were ligated into pCR®2.1 (Invitrogen) and transformed into competent E. coli DH5α. Plasmids were isolated from clones with the Zyppy™ Plasmid Miniprep Kit (Zymo Research). Insertion was confirmed with digestion by EcoRI and sequence was confirmed using vector-specific primers M13F and M13R (Table 2 ). Gene copy numbers were calculated using the concentration of each plasmid assuming 1.096 × 10−12 g bp−1 [40 (link)]. Standard curves were generated from ten-fold dilutions of DNA with known copy numbers and were analyzed by qPCR in triplicate.
| MIcards1up | cards1 | ATCGTCTGGTGCATATGCAACAGC |
| MIcards1down | ATCGGCTCATGCAAGTGTTGCAGC | |
| MIglpFup | glpF | ATCGGTAGTGCTTTTGCACTACAC |
| MIglpFdown | ATCGCTTCCAATGATTCCACCTCC | |
| MIkatEupSalI | katE | ATCGGTCGACAAATGCTGCAACAGCTGCAC |
| MIkatEdownSalI | ATCGGTCGACTAAACACAAAATTTGATTTAATCAAAATTCATG | |
| MIsodup | sodA | ATCGGAACTGGGCCAACAAATGAC |
| MIsoddown | ATCGACTTCACATGTCAGTTAGGG | |
| M13Forward | Sequencing | GTTGTAAAACGACGGCCACT |
| M13Reverse | CAGGAAACAGCTATGACC |
5
Heterologous Expression of rPstS-1 in P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For culture media components, peptone, yeast extract, and agar were purchased from Difco™ (Becton–Dickinson, Franklin Lakes, NJ, USA), methanol, peptone, dextrose, and salts were from JT Baker (Phillipsburg, NJ, USA), and sorbitol and Triton X-100 were obtained from Merck (Billerica, MA, USA). For molecular biology reagents, Zeocin™, T4 ligase, and PCR reagents were purchased from Thermo Fisher Scientific (Waltham, MA, USA), the PstI and KpnI restriction enzymes were purchased from Jena Bioscience GmbH (Jena, Germany), and the plasmid purification kit Zyppy™ Plasmid Miniprep Kit was bought from Zymo Research (Irvine, CA, USA). Protein precipitation, SDS-PAGE and western blotting reagents were purchased from Merck, and the Super Signal® West Pico Chemiluminescent substrate was purchased from ThermoFisher Scientific. The HPLC grade reagents acetonitrile and trifluoroacetic acid were purchased from JT Baker (Phillipsburg, NJ, USA). Plasmid propagation and subcloning steps were carried out in One Shot™ TOP 10 chemically competent E. coli purchased from ThermoFisher Scientific and cultured in Luria–Bertani medium (Merck). The expression of rPstS-1 was carried out in Pichia pastoris X-33 using the pPICZαB vector (ThermoFisher Scientific). E. coli His-tagged-rPstS-1 was expressed as previously described [23 (link)].
6
Molecular Cloning Techniques Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides were synthesized through Integrated DNA Technology. Unless otherwise indicated, all restriction enzymes, deoxynucleoside triphosphates, T4 DNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase were purchased from New England Biolabs and used according to the manufacturer’s suggestion. Plasmids and DNA gel bands were isolated using the Zyppy plasmid miniprep kit and Zymoclean gel DNA recovery kit, respectively (Zymo Research Corporation). Escherichia coli competent cells were prepared as previously described (Kang et al., 2007 (link)). DNA ligations, restriction endonuclease digestions, and agarose gel electrophoresis were performed according to standard techniques, and all other molecular techniques were carried out according to methods described previously by Sambrook and Russell (2001) .
7
Cloning and Expression of Mycobacterium Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H37Rv genomic DNA was received from Professor Ian Wiid, University of Stellenbosch, South Africa. The Mtb aroK gene (encoding Shikimate Kinase) in pET15-b was received from the laboratory of Chris Abell, University of Cambridge. All other genes were cloned in-house as outlined in section 5.3. All PCR reagents were from Kapa Biosystems (KAPA HiFi for gene amplification and KAPA 2G Fast for screening), and cloning materials were purchased from Epicentre Technologies, USA (Fast-Link™ DNA Ligation Kit) or Zymo Research, USA (Zyppy™ Plasmid Miniprep kit and Zymoclean™ Gel DNA Recovery Kit). Oligonucleotides for gene amplification were obtained from IDT Inc. (USA). All other chemicals used were at least analytical grade and were obtained from Sigma-Aldrich.
8
Amplification and Cloning of SDC-1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SDC-1 promoter segments were amplified from PC3 genomic DNA (100 ng) using high fidelity DNA polymerase (K2102, KAPA Biosystems). The primers used for amplification were: E-box 8-9-10 (−2200/−2050), (forward) 5′-TTCCGCCCAGGAGAAAACAGAAAAG-3′, (reverse) 5′-CCTTTCCCTGCCTCTCTTACAGC-3′; E-box 5-6 (−1500/−1300), (forward) 5′-GAGAGGTCGAGGCGATTCTCCC-3′, (reverse) 5′-TTTAAAAGTCACTCACGGCCAAG-3′; E-box 1 (−100/+40), (forward) 5′-AACTTGTTCCTCTGCTGTGGATGGC-3′, (reverse) 5′-CACTCCCAACAGCAGTTATGAGCA-3′. This primers have sequences of restriction enzymes KpnI and HindIII (R0142S y R0104S, New England Bioabs). Each SDC-1 promoter segment was sub-cloned in pCR8/TOPO/TA vector (K2520-20, Invitrogen). Plasmidial DNA was extracted through Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) and sequenced by Macrogen Inc. (Korea).
9
Methylation Analysis of IRF8 Promoter
10
Plasmid Isolation, Sequencing, and Annotation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli strain CM6 was selected for plasmid isolation and sequencing. The plasmid was extracted from an overnight culture of the selected strain grown in LB broth (BD DIFCO, Mexico) and purified using a Zyppy Plasmid Miniprep Kit (Zymo Research, CA, U.S.A). The plasmid was sequenced with an Illumina HiSeq 2000 sequencing platform at the Macrogen Korea Institute (Seoul, Republic of Korea) using a whole-genome shotgun library strategy. The plasmidic DNA sequence was reconstructed using multiple bioinformatic tools. The sequence reads were assembled using the genome assembler program SPAdes v3.1.1.18 (link) The initial contigs were compared with the Plasmids database from NCBI GenBank (accessed April 2016) using Blast+. The best matches indicated a high similarity with pHK plasmid family, then we use pHK17a as a template to reorder the contigs and reconstruct the full plasmid. Open reading frames (ORFs) were deduced and annotated by using NCBI Glimmer v3.02.19 (link), 20 (link), 21 (link) ORF sequences were analyzed against protein family databases to obtain information about their functionality.22 (link), 23 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!