Sybr green detection

The primers of miRNA were designed by tailing reaction on Sangon online software (https://www.sangon.com/newPrimerDesign, accessed on 20 August 2020) (Table 1). miRNA First Strand cDNA Synthesis (Tailing Reaction) (Sangon, Shanghai, China) was used for reverse transcription of RNA to cDNA. qPCR was carried out in Y480 Real-Time PCR Detection System (Roche, Basel, Switzerland) utilizing SYBR green detection (Takara Bio, Tokyo, Japan). The amplification protocol was as follows: 95 °C for 30 s, followed by 50 cycles of 95 °C 10 s, and 60 °C for 30 s. Melt curve analysis was performed between 55 and 95 °C, with a 0.5 °C increment every 5 s. Samples were run in triplicate. Forward primers were listed in Table 1 and reverse primers were provided in the cDNA Synthesis kit. U6 was used as the reference gene, its primers were kept secret and also provided in cDNA Synthesis kit. All expression levels were normalized to that of U6 and quantified using the 2-ΔΔCt method [12 (link)]. Twelve differentially expressed miRNA (DEMs) (fold-change > 2 and false discovery rate (FDR) < 0.05) were randomly chosen for verification by qPCR.

Livers were harvested after collecting blood. For lipid accumulation analysis, left liver lobes were fixed, embedded in paraffin and sectioned for staining with Oil Red O. Total RNA from livers was extracted using TRIzol reagent (Life Technologies, Grand Island, NY, USA). cDNA was synthesized using oligo‐dT and random primers (Takara, Tokyo, Japan). The levels of target genes were measured using quantitative real‐time polymerase chain reaction (PCR) (LightCycler 480 II; Roche, Switzerland) with SYBR green detection (Takara). The level of each target gene was normalized to the β‐actin level. All primer (Sangon Biotech, Shanghai, China) sequences are shown in Table S1.

Total RNA was extracted from approximately 30 embryos using RNAqueous micro kit (Cat No. AM1931, Ambion, Life Technologies, USA) according to the manufacturer’s instruction followed by treatment with DNAse 1. cDNA was synthesized using Protoscript First strand cDNA synthesis kit (Cat No. E6300S, New England Biolabs Inc, USA). 1 μL cDNA was used to determine the mRNA levels of P53, Bax and Bcl-2 with SYBR Green detection (Cat No. RR420, Takara, Japan) on Step One Real time PCR system (Applied Biosystems, USA). Primer sequences for qRT-PCR are provided in supplementary information (Table S1). Exon-spanning primers were used to avoid amplification of genomic DNA. Reactions were performed in triplicates in a total volume of 20 μL. The transcript levels were normalized to GAPDH. A minimum of 3 biological and 3 technical replicates were assessed.

Quantification of CLCuMuV and CLCuMuB in whitefly individuals was performed after various feeding durations on CLCuMuV and CLCuMuB -infected cotton plants. Five hundred nonviruliferous 7 to 8-day-old adults of each species were transferred to feed on CLCuMuV and CLCuMuB -infected cotton plants to acquire the virus. Two detection experiments were conducted on the whiteflies. In the first experiment, 10 female and 10 male adults were collected after a 48 h AAP. In the second experiment, 10 adults without the discrimination of sex were randomly collected from each plant at the end of a 6, 12, 24 and 48 h AAP, respectively. Each experiment was replicated three times. The collected whitefly samples were stored at −20 °C.
The DNA of the 10 whitefly adults was extracted with an Easy Pure Genomic DNA Kit (Trans Gen Biotech, Beijing, China). The DNA samples were stored at −20 °C. The primer sequences used for real-time PCR analysis are shown in Table 2. The β-actin gene was used in each sample as a normalization gene to verify equal quantity of whitefly genomic DNA. Amplifications were performed using SYBR^® Premix Ex Taq™ (Takara, Liaoning, China) and a CFX 96™ real-time PCR system (Bio-Rad, Hercules, CA, USA) with SYBR green detection (Takara, Liaoning, China). The relative quantity of viral DNA was calculated using the 2−ΔCt method (Guo et al., 2015 (link)).

The cells were treated with 0.5 mM H₂O₂ with or without 5000 U/ml Catalase at 37°C for 1 h. At 0 h and 48 h time-point post treatment, the cells were collected and their genomic DNA was isolated as above. Measurement of common deletion (CD) was performed by real-time PCR using SYBR Green detection (Takara) on a CFX96 (Bio-Rad). The sequence spanning the CD was amplified using the primers: CD-F, 5′-ACCCCCATACTCCTTACACTATTCC and CD-R, 5′-AAGGTATTCCTGCTAATGCTAGGCT. The 83 bp fragment serving as internal standard for total mtDNA was amplified with primers: IS-F, 5′-GATTTGGGTACCACCCAAGTATTG and IS-R, 5′- AATATTCATGGTGGCTGGCAGTA (25 (link),26 (link)).

Total RNA from the tissues or transfected cells was extracted by TRIzol reagent (Invitrogen). For miRNA, the extracted RNA was reverse-transcribed using the TaqMan MicroRNA Assay Kit and miRNA-specific stem-looped RT primer (Applied Biosystems, Foster City, CA). The relative level of miRNA was measured by miScript SYBR® green PCR kit (Qiagen GmbH), and the reaction mixture consisted of 10 µl of 2× QuantiTect SYBR Green PCR Master Mix, 2 µl specific microRNA primer, 2 µl of 10× miScript Universal Primer, 2 µl cDNA template and RNase-free water. For mRNA level detection, cDNA was synthesized by Prime Script RT reagent kit (Takara) and reacted at 65°C for 5 min, 30°C for 6 min and 50°C for 1 h. The relative mRNA levels were determined by the SYBR green detection (Takara) using LightCycler 480 Real-Time PCR System (Roche Diagnostics, Basel, Switzerland). The amplification conditions of miRNA and mRNA were as follows: 95°C for 15 min, 94°C for 15 s, 55°C for 30 s and 70°C for 30 s for 45 cycles and finally extended at 72°C for 10 min. Data were calculated by the 2^−ΔΔC_t method [20 (link)]. The relative level of miR-151a-3p was normalized by U6 and GAPDH served as an internal control for other genes. All primers are listed in Table 1.