Total RNA was isolated from the hippocampus using a total RNA extraction kit (BioTeke Corporation, Beijing, China), according to the manufacturer’s protocol. RNA purity and concentration were determined using a NANO2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). Complementary DNA (cDNA) was reversely transcribed with an oligonucleotide primer using a super Moloney murine leukemia virus (M-MLV, BioTeke). qPCR was carried out in 20 μl of the reaction system containing 1 μl of cDNA, 10 μl of 2 × Power Taq PCR Master Mix (BioTeke) and SYBR Green (Solarbio), 0.5 μl of forward and reverse primer (10 μM, Table 1 ) dissolved in double-distilled water on an Exicycler 96 (Bioneer, Daejeon, Korea). All tests were conducted in triplicate. Copy numbers of RNA were quantified using the comparative ΔΔCt method, with β-actin or U6 as the internal control.
Sybr green
Manufactured by Solarbio
Sourced in China, United States
SYBR Green is a fluorescent dye used in molecular biology applications. It binds to double-stranded DNA and emits a green fluorescent signal upon excitation, allowing the quantification of DNA levels. The dye is commonly used in real-time PCR (qPCR) and other DNA detection techniques.
Automatically generated - may contain errors
Lab products found in correlation
Beyort 2 m mlv reverse transcriptase, by Beyotime (23 mentions)
Taq pcr mastermix, by Solarbio (21 mentions)
Trizol reagent, by Thermo Fisher Scientific (18 mentions)
Exicycler 96, by Bioneer (16 mentions)
Power taq pcr mastermix, by BioTeke (14 mentions)
Rnasimple total rna kit, by Tiangen Biotech (11 mentions)
Tripure, by BioTeke (11 mentions)
Tripure reagent, by BioTeke (10 mentions)
Beyort 2 m mlv, by Beyotime (8 mentions)
M mlv reverse transcriptase, by Tiangen Biotech (7 mentions)
Super m mlv reverse transcriptase, by BioTeke (7 mentions)
Nano 2000, by Thermo Fisher Scientific (7 mentions)
Exicycler 96 real time pcr system, by Bioneer (7 mentions)
Taq pcr mastermix, by Tiangen Biotech (5 mentions)
Exicycler 96 real time quantitative thermal block, by Bioneer (5 mentions)
Exicycler 96 system, by Bioneer (4 mentions)
Rnase inhibitor, by Tiangen Biotech (4 mentions)
Tripure lysis buffer, by BioTeke (4 mentions)
M mlv first strand kit, by Thermo Fisher Scientific (4 mentions)
Rnase inhibitor, by BioTeke (3 mentions)
113 protocols using sybr green
1
Quantitative RT-PCR Analysis of Hippocampal RNA
2
Quantitative Analysis of circRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the instruction provided by the manufacturer, total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA), and cDNA was synthesized using cDNA Synthesis SuperMix (Transgen, Beijing, China). Quantitative analysis was carried out using SYBR Green (Solarbio, Beijing, China) on Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The thermocycling conditions were as below: 95°C for 10 min, 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 42 s. The data were analyzed by the 2−ΔΔCt method and normalized using 18S ribosomal RNA (rRNA) or U6. All primers were presented as follows: circ_0007031, F 5ʹ-ATCATTGCTGCACACGAGGT-3ʹ, R 5ʹ-AGGACCTTCCTAGACTGATCCA-3ʹ; TUBGCP3, F 5ʹ-TATGTGGAGCAGATCGAGAAG-3ʹ, R 5ʹ-TTGATGGACCTGAGGTGAG-3ʹ; 18S rRNA, F 5ʹ-ATCGGGGATTGCAATTATTC-3ʹ, R 5ʹ-CTCACTAAACCATCCAATCG-3ʹ; miR-760, F 5ʹ- TCAATCCACCAGAGCATGGATAT-3ʹ, R 5ʹ-CTCTACAGCTATATTGCCAGCCA-3ʹ; U6, F 5ʹ-CTCGCTTCGGCAGCACATATACT-3ʹ, R 5ʹ-CGCTTCACGAATTTGCGTGT-3ʹ.
3
Quantifying miRNA and mRNA Expression in Ovarian Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA expression of miR-1224-5p, NLRP3, ASC, FOXO1 and TXNIP was quantified by real-time PCR [29 (link),30 (link)]. Total RNA was obtained from the ovarian tissue of mice or KGN cells by an RNA extraction kit (Tiangen Biotech, Beijing, China). The concentration was quantified by a UV spectrophotometer (Thermo Scientific, Rockford, IL, USA). The RNA sample was then reversibly transcribed into cDNA in a PCR system (Bioneer Corporation, Daejeon, Korea). Quantitative real-time analysis was conducted in the PCR system using the cDNA, SYBR Green (Solarbio Science & Technology), primers (Genscript, Nanjing, China) and 2× Taq PCR Master Mix (Tiangen Biotech). Data were analyzed by 2−ΔΔCt formula and normalized to U6 or GAPDH. The sequences of primers are shown in Table 1 .
The sequences of primers
| Gene | Forward primer (5ʹ-3ʹ) | Reverse primer (5ʹ-3ʹ) |
|---|---|---|
| Mus musculus-miR-1224-5p | GTGAGGACTGGGGAGGTG | GTGCAGGGTCCGAGGTATTC |
| Homo sapiens-miR-1224-5p | GTGAGGACTCGGGAGGTG | GTGCAGGGTCCGAGGTATTC |
| NLRP3 | TTCGGAGATTGTGGTTGGG | AGGGCGTTGTCACTCAGGT |
| ASC | TGGATGCTCTGTACGGGAAGGT | TGTTGCTGGGAAGGAGCCTC |
| FOXO1 | GTCCTACGCCGACCTCATC | TTGCTGTCACCCTTATCCTTG |
| TXNIP | GTCATCAGTCAGAGGCAATCA | AGGAACGCTAACATAGATCAGTAA |
4
Quantification of miR-665 and CRIM1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAios Plus (Takara Bio Inc., Shiga, Japan) was used to extract total RNA from cell lines and tissues, according to the manufacturer’s instructions. Reverse transcription and qRT-PCR of miR-665 were performed using the Hairpin-it™ miRNA RT-PCR Quantitation Kit (Gene Pharma, Shanghai, China), with U6 RNA as the internal reference. RNA reverse transcription was synthesized with the PrimerScriptTM reagent kit (Takara, Dalian, China) and SYBR Green (Solarbio, Beijing, China) was utilized to analyze the CRIM1 mRNA expression level, where glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an endogenous control. The Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, US) was used to perform qRT-PCR. All primers were as follows: miR-665 sense, 5′-GGTGAACCAGGAGGCTGAGG-3′, miR-665 antisense, 5′-CAGTGCAGGGTCCGAGGTAT-3′, U6 sense, 5′-CGCTTCGGCAGCACATATAC-3′, U6 antisense, 5′-TTCACGAATTTGCGTGTCATC-3′, CRIM1 sense, 5′- AGTTTCCAAGTCAGGATATGTGC-3′, CRIM1 antisense, 5′- AGCATAACCCTCGATCAGAACA-3′, GAPDH sense, 5′-AGCCACATCGCTCAGACTC-3′, GAPDH antisense, 5′- GCCCAATACGACCAAATTC −3′.
5
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR was performed to detect the mRNA level of genes. Total RNA was extracted from cells using TriPure reagent, chloroform, and isopropanol following the manufacturer’s instructions. For mRNA detection, RNA was reverse transcribed by using BeyoRT II M-MLV reverse transcriptase (Beyotime, Shanghai, China), and quantitative RT-PCRs were conducted using gene-specific primers, SYBR Green (Solarbio), and 2 × Taq PCR Master Mix. Quantitative normalization was performed using the expression of β-actin. Relative mRNA expression was calculated using the 2−ΔΔCT method. Primer sequences were provided in Supplementary Table 1 .
6
Quantitative Real-Time PCR for Knockdown Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was used to determine the relatively higher knockdown efficiency of shRNA and siRNA for further experiments. Total RNA was extracted from OS cells using TRIpure Reagent (Bioteke, Beijing, China). The BeyoRT II M-MLV Reverse Transcriptase (Beyotime Biotechnology, Shanghai, China) and RNase inhibitor (Bioteke, Beijing, China) were used for reverse transcription. The 2×Taq PCR MasterMix and SYBR Green (Solarbio, Beijing, China) were employed to carry out the qRT-PCR assay. In order to normalize lncRNA and mRNA expression, β-actin was used as an endogenous control. 2−ΔΔCt was used to calculate the relative expression level of the target RNA. Table S3
7
Quantitative Analysis of Tight Junction Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from nasal mucosa tissues or cells by employing an RNA Simple Total RNA Kit (Tiangen, Beijing, China). The cDNA synthesis was performed by a BeyoRT II M-MLV reverse transcriptase (Beyotime, Shanghai, China). 2×Taq PCR MasterMix (Solarbio) and SYBR Green (Solarbio) were used to quantify the expression of genes. The relative expression of mRNA was calculated by 2 –ΔΔCtmethod. GAPDH was used as the internal control. The sequences of primer were shown in Table 2 .
The Sequences of Primer Used in qRT-PCR
| Genes | Forward Sequences (5’-3’) | Reverse Sequences (5’-3’) |
|---|---|---|
| MAFB (mus) | TCACCTGGAGAACGAGAAGACG | AAGCCGGAGTTGGCGAGT |
| Occludin (mus) | CCTGGAGGTACTGGTCT | ATCTTTCTTCGGGTTTT |
| ZO-1 (mus) | TGCCTCGAACCTCTACTC | GTGGTGGAACTTGCTCAT |
| GAPDH (mus) | TGTTCCTACCCCCAATGTGTCCGTC | CTGGTCCTCAGTGTAGCCCAAGATG |
| MAFB (homo) | AGCACCACCTGGAGAATGAGA | AAGCCGGAGTTGGCGAGT |
| ZO-1 (homo) | CCAGTCCCTTACCTTTCG | CTGCCTCATCATTTCCTC |
| Occludin (homo) | CCTCTTGAAAGTCCACCTC | GCCTACACTACCTCCTAAAA |
| GAPDH (homo) | GACCTGACCTGCCGTCTAG | AGGAGTGGGTGTCGCTGT |
8
Quantitative Analysis of SPRED1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells of bone marrow samples and cell lines using the TRIpure (BioTeke, Wuxi, China) and reverse transcribed using a Super M-MLV Reverse Transcription Reagent Kit (BioTeke) according to the manufacturers’ protocol. Quantitative reverse transcription PCR (RT-PCR) was performed using 2× Power Taq PCR MasterMix (BioTeke) and SYBR Green (Solarbio, Beijing, China) as a double-stranded DNA-specific dye. Specific primer sequences of SPRED1 designed by Sangon Biotech (Shanghai, China) were as follows: forward: 5′-TTTTCTGATCCCTGTTCGTG-3′ and reverse: 5′-TCCAGCAGCTTTATGTTTCC-3′. The following steps of RT-PCR followed protocols in our laboratory. The relative level of SPRED1 was analyzed using the Exicycler™ 96 System (BIONEER, Daejeon, Korea) and calculated using the 2−ΔΔCt method.
9
Quantitative RT-PCR Analysis of Liver Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using TRIpure reagent (BioTeke, Beijing, China) from liver tissues and LX‐2 cells. Then total RNAs were reversely transcribed into first‐strand cDNA using Super M‐MLV (BioTeke). Quantitative real‐time PCR was carried out using 2 × Power Taq PCR MasterMix (BioTeke) and SYBR Green (Solarbio, Beijing, China) on an Exicycler™ 96 real‐time quantitative thermal block (Bioneer, Daejeon, Korea). The primers used for PCR amplification were listed in Table 1 . Expression values of mRNAs and miRNAs were normalized with β‐actin and U6 respectively. The relative expression levels were calculated by the 2−ΔΔCT method.
10
Gel Electrophoresis of Biomolecular Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Agarose gel (2 and 3%) was used for gel separation. In brief, 5 µL each sample was mixed with 1 μL of DNA loading buffer (6X) and loaded onto the gel. Electrophoresis separation was performed using a Bio-Rad electrophoresis system (USA) at 120 V for 20 min. The gels were visualized using a gel electrophoresis imaging system (Bio-Rad, USA).
For the verification of ligand covalent and self-assembly mechanism, PAGE (10%) was employed. Five microliters of each sample were mixed with 1 μL of DNA loading buffer (6×) and loaded onto the gel. Electrophoresis was conducted in 1× TBE buffer at 80 V for 80 min. The resultant gels were stained with SYBR green (10,000×, Solarbio Science & Technology Co., Ltd. (Beijing, China)) for 0.5 h in the dark and imaged using a Bio-Rad imaging system.
For the verification of ligand covalent and self-assembly mechanism, PAGE (10%) was employed. Five microliters of each sample were mixed with 1 μL of DNA loading buffer (6×) and loaded onto the gel. Electrophoresis was conducted in 1× TBE buffer at 80 V for 80 min. The resultant gels were stained with SYBR green (10,000×, Solarbio Science & Technology Co., Ltd. (Beijing, China)) for 0.5 h in the dark and imaged using a Bio-Rad imaging system.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!