De81 paper

Unless indicated otherwise, all oligonucleotide-based helicase assays (15 µl volume) with Dna2-E675A were performed in the reaction buffer used for the nuclease assays supplemented with 50 mM KCl, using Y-shaped DNA as substrate (oligonucleotides X12-3HJ3 and X12-3TOPL or PC92 and X12-4SC, as indicated, 0.1 nM, in molecules). Recombinant proteins were added as indicated. The reactions were incubated at 30 °C for 30 min and stopped using 5 µl 0.2% stop buffer containing 0.2% SDS, 150 mM EDTA and 30% glycerol, and 1 µl proteinase K (14–22 mg/ml, Roche), and incubated at 37 °C for 10 min. To avoid re-annealing of the substrate, the stop solution was supplemented with a 20-fold excess of the unlabeled oligonucleotide with the same sequence as the ³²P-labeled one. The products were separated by 10% polyacrylamide gel electrophoresis in TBE buffer, dried on 17 CHR chromatography paper (Whatman) and analyzed as described above. Plasmid based helicase assays (15 µl volume) were performed in the same way, except 2.2-kbp-long DNA substrate (0.1 nM, in molecules) was used. The products were separated by 1% agarose (Sigma, A9539) gel electrophoresis in TAE buffer, squeezed, dried on DE81 paper (Whatman) and analyzed.

DNA polymerase assays were performed as described previously (46 (link)). The standard reaction mixture (25 μl) contained 20 mM HEPES–NaOH (pH 7.5); 50 mM NaCl; 0.2 mg/ml BSA; 1 mM DTT; 10 mM MgCl₂; 1 mM ATP; 0.1 mM each of dGTP, dATP, dTTP, and [α-³²P]dCTP; 33 fmol (240 pmol for nucleotides) of singly primed ss M13mp18 DNA with the 36-mer primer CAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGG; RPA (9.1 pmol); PCNA (1.0 pmol trimer); RFC (0.26 pmol); polymerase δ (pol δ; 0.38 pmol); E1 (0.85 pmol); MMS2-UBC13 (16 pmol); RAD6-(RAD18)₂ (0.62 pmol); ubiquitin (174 pmol); and the indicated amounts of HLTF. Reaction mixtures lacking pol δ were preincubated at 30°C for 1 min, and reactions were started by addition of pol δ. After incubation at 30°C for 10 min, reactions were terminated with 2 μl of 300 mM EDTA, and the mixtures were immediately chilled on ice. Samples (5 μl) were spotted on DE81 paper (Whatman), which was washed three times with 0.5 M Na₂HPO₄. The amount of incorporated [α-³²P]dCMP into DNA was determined as the radioactivity retained on the paper. For electrophoretic analysis of replication products, 5 μl samples were mixed with 1 μl of loading buffer (150 mM NaOH/10 mM EDTA/6% sucrose/0.1% bromophenol blue) and electrophoresed on 0.7% alkaline–agarose gels as described previously (50 (link)).

DNA end resection assays (15 µl volume) were performed in 25 mM Tris-acetate pH 7.5, 2 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg/ml BSA, 80 U/ml pyruvate kinase, 1 mM phosphoenolpyruvate, 100 mM NaCl and randomly labeled 2.2-kbp-long double-stranded DNA substrate (0.5 nM, in molecules). The products were separated by 1% agarose gel electrophoresis in TAE buffer, dried on DE81 paper (Whatman) and analyzed.

Assays were performed with pUC19 DNA linearized with KpnI and then 3′ labeled with [α-³²P] ATP and terminal deoxytransferase (NEB). For the DNA2 resection machinery, reactions were conducted using 50 nM of substrate in standard buffer (20 mM Na-HEPES pH 7.5, 0.1 mM DTT, 0.05% Triton X-100, 100 µg/mL BSA). Two millimolar ATP and 5 mM MgCl₂ were added to the reaction buffer immediately before reconstitution of the resection machineries. The reactions were initiated on ice by adding either NAD, PARP-1, PARP-2 or PARP-3 as indicated in the figure and transferred immediately to 37 °C. After 5 min, the order of addition and incubation of the respective protein components were: MRN (10 nM, 5 min), RPA (100 nM, 5 min), BLM (15 nM, 3 min) and DNA2 (15 nM, 45 min). For the EXO1 resection machinery, reactions were conducted using resection buffer (25 mM MOPS pH 7, 60 mM KCl, 1% Tween 20, 2 mM DTT, 5 mM MgCl2, 2 mM ATP) and the same proteins and time of incubation as mentioned above except for EXO1 at a concentration of 10 nM instead of DNA2. Reactions were followed by proteinase K treatment for 30 min at 37 °C. Products were analyzed on a 1% native agarose gel. Gels were dried on DE81 paper (Whatman) and signals were detected by autoradiography. Densitometric analyses were performed using the FLA-5100 phosphorimager (Fujifilm) and quantified using the Image Reader FLA-5000 v1.0 software.