Fecal bacterial isolation, DNA and RNA extraction was conducted as described previously (25 (link)). Levels of expression of E. coli adiA, cadA, and speA genes in the CRC and control microbiota cultures (from pooled total fecal bacteria, for each cohort) in response to acids, osmotic, and oxidative pressure were measured by quantitative reverse transcription (qRT)-PCR, with annealing temperature of 56°C for all reactions, as described (25 (link)). Mann-Whitney U tests for qRT-PCR (P < 0.05) were conducted to establish statistically significant differences in gene expression between the CRC and control groups. qRT-PCR was conducted using gene specific primers (Table 2 ), and 16S rRNA gene primers were used for normalization as described (25 (link)). Primer specificity was confirmed by Sanger sequencing by Eurofins after cloning PCR fragments into a TA pGEM-T Eazy cloning vector, Promega as described (25 (link)). Additionally, the SYBR Green iTaq (Bio-Rad) qRT-PCR system was tested with the 16S rRNA gene primers for contamination (water as the template) and DNA contamination of the RNA samples (proportionally to the amount of cDNA used for amplification diluted RNA samples were used as the templates for PCR). No amplification was observed for all control samples.
Itaq sybr green
Manufactured by Bio-Rad
Sourced in United States
ITaq SYBR Green is a real-time PCR master mix designed for sensitive and reliable detection of target sequences. It contains the necessary reagents, including iTaq DNA polymerase, SYBR Green I dye, and optimized buffer components, for efficient amplification and fluorescent detection of DNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (13 mentions)
Iscript reverse transcriptase, by Bio-Rad (12 mentions)
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Rneasy mini kit, by Qiagen (9 mentions)
Rneasy kit, by Qiagen (9 mentions)
Iscript cdna synthesis kit, by Bio-Rad (8 mentions)
Direct zol rna miniprep plus kit, by Zymo Research (7 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (7 mentions)
Rnaeasy rna extraction kit, by Qiagen (6 mentions)
Cfx96 real time system, by Bio-Rad (5 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (4 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (4 mentions)
Iscript cdna kit, by Bio-Rad (4 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Oligo dt primer, by Thermo Fisher Scientific (3 mentions)
Rneasy rna extraction kit, by Qiagen (3 mentions)
Nucleospin rna extraction kit, by Macherey-Nagel (3 mentions)
Taq dna polymerase with standard taq buffer, by New England Biolabs (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
82 protocols using itaq sybr green
1
Profiling E. coli Stress Response Genes
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA isolation was performed using ‘TRIzol’ (Invitrogen, USA) according to the company instructions. The RT-PCR was performed with ‘Superscript II Reverse Transcriptase’ (Invitrogen), according to company instructions. The PCR was performed with ‘Taq DNA Polymerase with Standard Taq Buffer’ (NEB) according to company’s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer’s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083 ) are listed in Supplementary Material, Table S3 .
3
Macrophage gene expression profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted by Trizol method (Sigma) and RNA concentration was measured on NanoDrop (Thermo). For cDNA synthesis, 1 μg of total RNA from each sample was used to transcribe cDNA using the iScript cDNA synthesis kit (Bio-rad) as per the manufacturer's protocol. Levels of arg, nos2, cd40, cd80, cd86, cd163, il-1β, il-10, and il-12p40 expressions were determined in the treated and untreated infected macrophages (IM) by quantitative PCR (qPCR), with β-actin as an endogenous control (Primer sequences in supplementary table no. 1 ). Subsequently, qPCR was carried out in 10 μl reaction mixture containing 2X SYBR green iTaq (Bio-Rad, USA), using CX96 (Biorad). Relative gene expression was analyzed by the Livak method.
4
Reverse Transcription and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR, reverse transcription (RT) of microbial RNA was conducted. Mix1 (100 μM d[N6] random primer, 25 mM deoxynucleoside triphosphate [dNTP]) of 1.5 μL was added to 4.5 μL of total RNA (0.5 μg/μL), and incubated at 65°C for 5 min to melt the local RNA secondary structure and placed on ice for 2 min. Mix2 (5X RT buffer and 100 mM dithiothreitol [DTT]) of 3 μL was added and incubated at 25°C for 2 min for efficient primer annealing. Reverse transcriptase SuperScript II (Invitrogen) 200U (1 μL) was added in a final volume of 10 μL, and samples were incubated at 42°C for 90 min followed by 5 min at 75°C, and stored at –80°C. A 50-fold dilution of cDNA was used for quantitative PCR. The SYBR Green iTaq (Bio-Rad) qRT-PCR system was tested with the 16S rDNA primers for contamination (water used as the template), and DNA contamination of the RNA samples (proportionally to the amount of cDNA used for amplification, diluted RNA samples were added as templates for PCR). No amplification was observed for all the control samples.
5
Quantitative Analysis of Neural Progenitor Genes
6
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LSVs. The RNA isolation was performed using "TRIzol" (Invitrogen, USA) according to company instructions. The reverse transcription (RT-PCR) was performed with "Superscript II Reverse Transcriptase" (Invitrogen), according to company instructions. The polymerase chain reaction (PCR) was performed with "Taq DNA Polymerase with Standard Taq Buffer" (NEB)
according to company´s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer´s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083) are listed in Supplemental Table S3.
according to company´s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer´s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083) are listed in Supplemental Table S3.
7
RNA Extraction and Analysis from Muscle Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from gastrocnemius muscles using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to previous studies (9 (link),26 (link),35 (link),61 (link)). The RNA concentration and quality were determined using a CFX96™ Real-Time PCR Detection system using iTaq™ SYBR-Green (both from Bio-Rad Laboratories, Inc., Hercules, CA, USA). The samples were treated with recombinant DNase I (DNA-free DNA removal kit; Ambion, Austin, TX, USA) to remove possible DNA contamination. RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manu facturer’s protocol. The PCR cycling conditions were as follows: Initial pre-denaturation of 95°C for 1 min, denaturation for 15 sec, annealing of 55–65°C for 20 sec and extension of 72°C for 30 sec. A total of 50 cycles were performed. 18S ribosomal RNA was used as an internal control. PCR primer sequences are listed in Table I . For quantitative analysis, the intact control muscle tissue was used as the control, and the relative expression of Atrogin-1, MuRF 1, PI3K p85α, Akt1, Adenosine A1R, TRPV4, Myostatin and SIRT1 was calculated using the 2−ΔΔCt method (62 (link)).
8
Transcriptional Response of Waddlia-infected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Waddlia-infected cells were harvested in TRIzol (AmbionR, Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) at different times post infection, as previously described (56 (link)). RNA-extraction was performed according to the manufacturer’s instructions. RNA was re-suspended in 60 µL of water and treated with the DNA-free DNA removal kit (Invitrogen, Thermo Fisher Scientific) to remove DNA contaminations. Random primers and the GoScript Reverse Transcription kit (Promega, Duebendorf, Switzerland) were used to obtain cDNA. Gene expression was analyzed by quantitative PCR on 4 µL of fivefold diluted cDNA using iTaq SYBR Green (Bio-Rad, Cressier, Switzerland), and the primers listed in Table 3 . Reactions were conducted on a QuantStudio3 system (Applied Biosystems, Thermo Fisher Scientific) using the following cycling conditions: 10 min at 95°C, 40 cycles of 15 s at 95°C, and 1 min at 60°C. Results were analyzed (with the ΔΔCt method) using 16S rRNA as endogenous control at 32 hpi (in the case of kinetic experiments) or the untreated sample (in the case of aberrant bodies) as reference sample. For fold changes ≤0.5 or ≥2, significance was assessed by paired t-test on ΔCt values.
9
Quantifying Gene Expression in B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was assayed by real-time PCR as previously described (17 (link)). Briefly, RNA was prepared from B cells using the RNeasy mini kit (Qiagen), according to the manufacturer’s instructions. cDNA was prepared using avian myeloblastosis virus reverse transcriptase (Bio-Rad). Gene expression was then measured by real-time PCR using iTaq SYBR Green (Bio-Rad) and normalized with β2-microglobulin. The following primer sets were used: β2-microglobulin (F-CCCGCCTCACATTGAAATCC/R-GCGTATGTATCAGTCTCAGTGG); AID (AGAAAGTCACGCTGGAGACC/CTCCTCTTCACCACGTAGCA). Gene expression was also measured by real-time PCR using TaqMan chemistry. Primer and probe sets were obtained from Applied Biosystems for Aicda (Mm01184115_m1) and β-actin, which was used for normalization.
10
qRT-PCR Analysis of Mycobacterial Infection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!