Sybr green pcr master mix

Manufactured by Beyotime

Sourced in China, United States

SYBR Green PCR Master Mix is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, DNA polymerase, dNTPs, and other necessary reagents for PCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Beyotime (4 mentions) Cfx96 real time pcr system, by Bio-Rad (3 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Riboscript reverse transcription kit, by RiboBio (2 mentions) Abi 7900 system, by Thermo Fisher Scientific (2 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions) M mlv reverse transcriptase, by Beyotime (1 mentions) Rnaeasy animal rna isolation kit, by Beyotime (1 mentions) Rna isolation kit, by Beyotime (1 mentions) Primescript rt pcr kit, by Takara Bio (1 mentions) Hoechst 33342, by Merck Group (1 mentions)

Close spelling variants of this product

SYBR Green mix (9 citations) PCR Master Mix (8 citations) SYBR Green (4 citations)

10 protocols using sybr green pcr master mix

Quantitative Analysis of NEAT1, miR-370-3p, and Irak2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the TRIzol reagent (Beyotime). Then RNA was reversely transcribed to complementary DNA (cDNA) by PrimeScript™ RT Master Mix kit (Beyotime). The qRT-PCR was conducted by SYBR Green PCR Master Mix (Beyotime) and data were analyzed using 2^−ΔΔCt method. β-actin and U6 were introduced as the inner references. Primers used in this study:
NEAT1 (forward 5′-GTAATTTTCGCTCGGCCTGG-3′, reverse 5′-TACCCGAGACTACTTCCCCA-3′); miR-370-3p (forward, 5′-GCCTGCTGGGGTGGAACCTGGT-3′, reverse 5′-CTCAACTGGTGTCGTGGA-3′); Irak2 (forward, 5′-CATGGCTTGCTACATCTACC-3′, reverse 5′-ACGTTTGTCTGTCCAGTTGA-3′); β-actin (forward 5′-GCACCACACCTTCTACAATG-3′, reverse, 5′-TGCTTGCTGATCCACATCTG-3′); U6 (forward, 5′-TCCGGGTGATGCTTTTCCTAG-3′, reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′).

Xiao T., Sun C., Xiao Y, & Li Y. (2020). lncRNA NEAT1 mediates sepsis progression by regulating Irak2 via sponging miR-370-3p. Biology Open, 9(6), bio049353.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from testicular tissues by using the Trizol reagent and was reverse-transcribed by a PrimeScript™ RT reagent kit (TaKaRa, Tokyo, Japan). RT-PCR was conducted by using SYBR Green PCR Master Mix (Beyotime, Nanjing, China) in the CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The mRNA levels were determined using the 2^−ΔΔCt method and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primary sequences used in this study are shown in the Supplementary Information, Table S3.

Xu Z., Qin Y., Lv B., Tian Z, & Zhang B. (2022). Effects of Moderate-Intensity Continuous Training and High-Intensity Interval Training on Testicular Oxidative Stress, Apoptosis and m6A Methylation in Obese Male Mice. Antioxidants, 11(10), 1874.

+ Open protocol

+ Expand

Quantifying Gene Expression using qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell RNA was extracted using the TRIzol reagent (Beyotime Institute of Biotechnology, Shanghai, China) and reverse transcribed to cDNA using M-MLV reverse transcriptase (Beyotime Institute of Biotechnology, Shanghai, China). qPCR analysis was performed using the SYBR Green PCR Master Mix (Beyotime) with the CFX96 Real-Time PCR System. The data were analyzed following the 2^−∆∆Ct method and calculated using β-actin as the normalization control. The sequences of primers used are presented in Table 2.

Liu S., Qiu Y., Gu F., Xu X., Wu S., Jin Z., Wang L., Gao K., Zhu C., Yang X, & Jiang Z. (2022). Niacin Improves Intestinal Health through Up-Regulation of AQPs Expression Induced by GPR109A. International Journal of Molecular Sciences, 23(15), 8332.

+ Open protocol

+ Expand

Liver RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the frozen liver tissues (15–20 mg) with the RNAeasy^TM animal RNA isolation kit with spin columns (R0024FT, Beyotime, Shanghai, China). A RevertAid first-strand cDNA synthesis kit (K1622, Thermo Scientific, Waltham, MA, USA) was used to transcribe mRNA into cDNA. RT-qPCR was performed by using SYBR Green PCR Master Mix (Beyotime) and a CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The primers were synthesized by Sangon (Shanghai, China). The primer sequences were as follows: Fndc5 (F:5′-GGCTGGGAGTTCATGTGGAA-3′; R:5′-TGGGAAGCGGTTATCTTTGCT-3′), Gapdh (F:5′-CAGTGCCAGCCTCGTCTCAT-3′; R:5′-AGGGGCATCCACAGTCTTC-3′).

Wang T., Yu M., Li H., Qin S., Ren W., Ma Y., Bo W., Xi Y., Cai M, & Tian Z. (2023). FNDC5/Irisin Inhibits the Inflammatory Response and Mediates the Aerobic Exercise-Induced Improvement of Liver Injury after Myocardial Infarction. International Journal of Molecular Sciences, 24(4), 4159.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using an RNA isolation kit (Beyotime) and reverse transcribed using an RT reagent kit (Beyotime) according to the manufacturer’s instructions. Quantitative PCR (qPCR) was performed using SYBR Green PCR master mix (Beyotime). The amplification program was as follows: pre-denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s, 60°C for 20 s. The primer pairs of the following genes were used:
lncRNA-Gm5532,
miR-125a-3p,
U6,
carbonic anhydrase II (
Car2),
cathepsin K (
CTSK),
GAPDH,
integrin β3,
MMP9, and
vacuolar-type H
⁺-ATPase
(
V-ATPase). The sequences of the primers are listed in
Table 1.
GAPDH was used as an internal control for gene expression assays, and
U6 was used as an internal control for miRNA assays. The expression levels of mRNA and miR-125a-3p were analyzed using the 2
^–ΔΔCt method.

Table 1 Sequences of primers used for quantitative real-time PCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
lncRNA-Gm5532	GCCACCACTCACACTGCTCT	CCTCTATGCTGGCTGACACG
miR-125a-3p	ACACTCCAGCTGGGACAGGTGAGGTTCTTG	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCTCCCA
U6	AGAGCCTGTGGTGTCCG	CATCTTCAAAGCACTTCCCT
Car2	CATTACTGTCAGCAGCGAGCA	GACGCCAGTTGTCCACCATC
CTSK	CAGCAGAACGGAGGCATTGA	CCTTTGCCGTGGCGTTATAC
GAPDH	TGCACCACCAACTGCTTAG	GGATGCAGGGATGATGTTC
integrin β3	CCACCTTCACCAATATCAC	CCAAATCCCACCCATACAC
MMP9	GCCCTGGAACTCACACGACA	TTGGAAACTCACACGCCAGAA
V-ATPase	CCACTGGAAGCCCAGTAAACAGA	GAACGTATGAGGCCAGTGAGCA

Zhang J., Zhang L., Yao G., Zhao H., Qiao P, & Wu S. (2023). lncRNA-Gm5532 regulates osteoclast differentiation through the miR-125a-3p/TRAF6 axis: lncRNA-Gm5532 regulates osteoclast differentiation. Acta Biochimica et Biophysica Sinica, 56(1), 54-61.

+ Open protocol

+ Expand

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from LO2 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A 1 μg aliquot of RNA was converted to cDNA. The sequences of primers used for PCR amplification are listed in Table 3. qRT-PCR was performed using SYBR Green PCR master mix (Beyotime, Haimen, China) on stepone™ quantitative RT-PCR system (Applied Biosystems, Waltham, MA, USA). A 20 μL reaction mixture was amplified using the following thermal parameters: denaturation at 95 °C for 2 min, 40 cycles of the amplification step (95 °C for 15 s and 60 °C for 15 s), and a final extension at 95 °C for 15 s and 60 °C for 15 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was served as the endogenous control. Relative mRNA expression levels were analyzed by the 2^−ΔΔCt method.

Li L., Zhu G., Fu G., Zha W, & Li H. (2022). Metabolic Syndrome Ameliorated by 4-Methylesculetin by Reducing Hepatic Lipid Accumulation. International Journal of Molecular Sciences, 23(18), 10465.

+ Open protocol

+ Expand

Cardiac Total RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of mouse cardiac was extracted using Trizol reagent. Reverse transcription was performed with the PrimeScript TM RT-PCR kit (TaKaRa, Tokyo, Japan). RT-PCR was detectedusing Quantitative PCR with SYBR Green PCR Master Mix (Beyotime, Nanjing, China) and CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The quantitative data were obtained with the 2^−ΔΔCt method and normalized to GAPDH. RT-PCR analysis was performed for fatty acid binding protein 1 (FABP1), fatty acid transporter 1 (FATP1), cluster of differentiation 36 (CD36), sterol regulatory element-binding factor 1 (SREBF1), fatty acid synthase (FAS), acetyl- CoA carboxylase α (ACCα), adipose triglyceride lipase (ATGL), lysosomal acid lipase (LAL), hormone-sensitive lipase (HSL), lipoprotein lipase (LPL), METTL3, METTL14, WTAP, FTO, ALKBH5, YTHDF1, YTHDF2, YTHDF3, YTHDC1, YTHDC2, and GAPDH. All primers were produced by Sangon (Shanghai, China), and the primers used in this study are shown in Table 1.

Xu Z., Qin Y., Lv B., Tian Z, & Zhang B. (2022). Intermittent Fasting Improves High-Fat Diet-Induced Obesity Cardiomyopathy via Alleviating Lipid Deposition and Apoptosis and Decreasing m6A Methylation in the Heart. Nutrients, 14(2), 251.

+ Open protocol

+ Expand

Hoechst33342 Staining and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The apoptotic nucleuses were observed with Hoechst33342. Cell culture and groups were the same as DCFH-DA treatment. Cells were xed with 4% paraformaldehyde for 20 minutes and the plates were washed 3 times with PBS for 5 minutes each time. 10ul of Hoechst33342 (B2261, Sigma-Aldrich, US, 200ug/ml in PBS,) was added to each well and incubated 5 minutes in the dark. Finally, anti-fade mounting media was used to seal the coverslips. Staining was observed in the uorescence microscopy.
Total RNA extracted and quantitative real-time polymerase chain reaction analysis Total RNA was extracted with TRIzol reagent (15596026, Invitrogen, Thermo Scienti c, Massachusetts, US) following the manual and DNA was generated by RevertAid First Strand cDNA Synthesis Kit (K1622, thermo scienti c, Massachusetts, US). Quantitative real-time PCR was performed by SYBR green PCR master mix (D7260, Beyotime Biotechnology, Shanghai, China) on CFX96 instrument. The reaction procedure was as follows: heating at 95°C for 5minutes and magni cation over 40 cycles of 95°C for 15seconds, 60°C for 30seconds and 95°C for 15 seconds. The primer sequence was as follows:

Wang L., Zeng Y.Q., Gu J.H., Song R., Cang P.H., Xu Y.X., Shao X.X., Pu L.J., Luo H.Y, & Zhou X.F. (2022). Novel oral edaravone attenuates diastolic dysfunction of diabetic cardiomyopathy by activating the Nrf2 signaling pathway. European journal of pharmacology, 920.

+ Open protocol

+ Expand

Quantitative PCR Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Trizol reagent (Beyotime, Shanghai, China) was utilized to isolate total RNA from tissues and cells. The complementary DNA (cDNA) was assembled using the riboSCRIPT Reverse Transcription Kit (Ribobio, Guangzhou, China). Then the amplification reaction was carried out using SYBR Green Master PCR mix (Beyotime) through the ABI 7900 system (Applied Biosystems, Foster City, CA, USA). The relative expression was normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or small nuclear RNA U6 and calculated using 2^−ΔΔCt method. The primers used were listed as below:
circ_0005962, F: 5′-AACTCCCCAGAGAAAGCCTGC-3′ and R: 5′-TGCTTGTGAAGCATTGGGGAT-3′; YWHAZ, F: 5′-ACTTTTGGTACATTGTGGCTTCAA-3′ and R: 5′-CCGCCAGGACAAACCAGTAT-3′; PDK4, F: 5′-GGAGCATTTCTCGCGCTACA-3′ and R: 5′-ACAGGCAATTCTTGTCGCAAA-3′; GAPDH, F: 5′-CTGGGCTACACTGAGCACC-3′ and R: 5′-AAGTGGTCGTTGAGGGCAATG-3′; miR-382-5p, F: 5′-ATCCGTGAAGTTGTTCGTGG-3′ and R: 5′-TATGGTTGTAGAGGACTCCTTGAC-3′; U6, F: 5′-CTCGCTTCGGCAGCACATATACT-3′ and R: 5′-ACGCTTCACGAATTTGCGTGTC-3′.

Zhang Z., Shan Z., Chen R., Peng X., Xu B., Xiao L, & Zhang G. (2021). circ_0005962 functions as an oncogene to aggravate NSCLC progression. Open Medicine, 16(1), 997-1009.

+ Open protocol

+ Expand

Circular RNA circ_0005962 Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zhang Z., Zhenxiu S., Chen R., Peng X., Xu B., Liang X., & Zhang G. (2020). Circ_0005962 functions as an oncogene to aggravate non-small cell lung cancer progression via circ_0005962/miR-382-5p/PDK4 regulatory network.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!