Superscript 2 preamplification system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Superscript II Preamplification System is a laboratory equipment designed to amplify target DNA or RNA sequences prior to downstream analysis. It provides a reliable and efficient method for increasing the quantity of specific genetic material from limited samples.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (8 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Qiashredder homogenizer, by Qiagen (2 mentions) Axiovert 200, by Zeiss (1 mentions) Live dead viability cytotoxicity kit, by Thermo Fisher Scientific (1 mentions) Iq sybr green supermix, by Bio-Rad (1 mentions) Isogen, by Nippon Gene (1 mentions) Maxima sybr green rox qrt pcr master mix, by Thermo Fisher Scientific (1 mentions) Dissociation curves software, by Thermo Fisher Scientific (1 mentions) Dnase 1, by Thermo Fisher Scientific (1 mentions) E z n a total rna kit, by Omega Bio-Tek (1 mentions) Maxima sybr green rox qpcr master mix, by Thermo Fisher Scientific (1 mentions) Abi prism 7500, by Thermo Fisher Scientific (1 mentions) Sybr green 1, by Roche (1 mentions) Lightcycler system, by Roche (1 mentions)

Spelling variants of this product

Superscript II (2725 citations) Superscript II system (72 citations) SuperScript Preamplification System (20 citations)

12 protocols using superscript 2 preamplification system

Cell Viability and Gene Expression Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A LIVE/DEAD Viability/Cytotoxicity Kit (Molecular Probes, Eugene, OR, USA) of the cell-printed structures at day 1 was used for checking that the cells had been printed properly. The sample was observed with a fluorescence microscope (Axiovert 200, Zeiss, Jena, Germany).
To evaluate PDL gene expression levels, 4 groups of samples were cultured for 7 d without any induction. Total RNA was prepared using a RNeasy Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA using reverse transcriptase (Superscript II Preamplification System; Invitrogen, Waltham, MA, USA). Oligonucleotide primers for the amplification of human ALP, CEMP1, and Col1 mRNA were designed. Real-time PCR was performed with SYBR Green PCR Master Mix (ABI Prism 7500 sequence detection system, Applied Biosystems, Waltham, MA, USA). The reaction conditions were: 40 cycles of 15 s of denaturation at 95 °C and 1 min of amplification at 60 °C. All reactions were run in triplicate and were normalized to the reference gene (GAPDH).

Lee U.L., Yun S., Cao H.L., Ahn G., Shim J.H., Woo S.H, & Choung P.H. (2021). Bioprinting on 3D Printed Titanium Scaffolds for Periodontal Ligament Regeneration. Cells, 10(6), 1337.

+ Open protocol

+ Expand

Characterizing Osteoblast and Macrophage Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse osteoblasts and from RAW264.7 cells using ISOGEN (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 5 μg of total RNA by reverse transcriptase (Superscript II Preamplification System, Invitrogen, Carlsbad, CA). The quantitative PCR (q‐PCR) was performed with iQ SYBR Green Supermix (Bio‐Rad). The primers used for the q‐PCR for the mouse RANKL, osterix, Col1a1, osteocalcin, BMP2, Nfatc1, RANK, and TRAP genes were constructed from the sequence of respective gene.
The RT‐PCR was performed to examine the mRNA expression of organic anion transporters (OATs), OAT1 and OAT3, in mouse osteoblasts, bone marrow macrophages, and RAW264.7 cells. The primer pairs used in the RT‐PCR for mouse OAT1, OAT3, and β‐actin genes were constructed from the sequence of respective gene. The PCR product was run on a 1.5% agarose gel and stained with ethidium bromide.

Watanabe K., Tominari T., Hirata M., Matsumoto C., Hirata J., Murphy G., Nagase H., Miyaura C, & Inada M. (2017). Indoxyl sulfate, a uremic toxin in chronic kidney disease, suppresses both bone formation and bone resorption. FEBS Open Bio, 7(8), 1178-1185.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Cartilage

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four knee joint specimens from both the control and experimental group were used for qPCR. Total RNA was extracted from cartilage using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) with QIAshredder homogenizers and the RNeasy Mini kit (Qiagen, Hilden, Germanay) according to the manufacturer’s protocol. One microgram of total RNA was used for random hexamer-primed cDNA synthesis using the SuperScript II pre-amplification system (Invitrogen, Carlsbad, CA,USA). Quantitative RT-PCR reactions were performed in triplicate using iQ5 (Bio-Rad, Hercules, CA, USA) with Maxima SYBR Green/ROX qPCR Master Mix (Thermo, Thermo Scientific, Rockford, IL, USA) and 300 nM of each primer. The primers were designed based on the sequences in the GenBank database. The primer pairs used for this study are shown in Table 1. Specificity of the reactions was confirmed by 2.5% agarose gel electrophoresis.Table 1

Primer sequences and product side for real-time PCR

Gene		5′ DNA sequence 3′	Amplicon length, base pairs
VEGF	Forward	CCCACGTCAGAGAGCAACA	101
	Reverse	TCACATCTGCTGTGCTGTAGG
Col10	Forward	AGGCAAGCCAGGCTATGGAA	83
	Reverse	GCTTCCCCGTGGCTGATATTC
MMP13	Forward	GCTGCGGTTCACTTTGAGAA	106
	Reverse	GGCGGGGATAATCTTTGTCCA

Takayama K., Kawakami Y., Kobayashi M., Greco N., Cummins J.H., Matsushita T., Kuroda R., Kurosaka M., Fu F.H, & Huard J. (2014). Local intra-articular injection of rapamycin delays articular cartilage degeneration in a murine model of osteoarthritis. Arthritis Research & Therapy, 16(6), 482.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from cultured cells using an RNeasy Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. One microgram total RNA was used for random-hexamer-primed cDNA synthesis with the SuperScript II pre-amplification system (Invitrogen). qRT-PCR reactions were performed in triplicate using iQ5 (Bio-Rad) and Maxima SYBR Green/ROX qRT-PCR Master Mix (Thermo Fisher Scientific), along with gene-specific primers. The primers were designed according to the sequences obtained from the GenBank database (Supplementary Table 1). Melting curve analysis was performed with Dissociation Curves Software (Applied Biosystems, Waltham, MA, USA). Results were obtained using sequence detection software (StepOne Software v2.3) and the mean cycle threshold (Ct) values were used to calculate gene expression normalized to that of mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Kawakami Y., Hambright W.S., Takayama K., Mu X., Lu A., Cummins J.H., Matsumoto T., Yurube T., Kuroda R., Kurosaka M., Fu F.H., Robbins P.D., Niedernhofer L.J, & Huard J. (2019). Rapamycin Rescues Age-Related Changes in Muscle-Derived Stem/Progenitor Cells from Progeroid Mice. Molecular Therapy. Methods & Clinical Development, 14, 64-76.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted by using TRIzol reagent (Invitrogen), and first-strand cDNAs were synthesized from 2 μg of RNA by using the SuperScript II Preamplification System (Invitrogen). Relative mRNA levels were determined using the ABI Prism 7500 sequence detection system with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) as previously described.^{25 (link)} Expression of target genes was determined according to the 2-ΔΔCT method using GAPDH as a reference gene. The following primer sequences were used: RANKL F: 5′-TGGAAGGCTCATGGTTGGAT-3′ and R: 5′-CATTGATGGTGAGGTGTGCA-3′ OPG F: 5′-TGGAACCCCAGAGCGAAACA-3′ and R: 5′-GCAGGAGGCCAAATGTGCTG-3′ CXCL10 F: 5′-ACTCCCCTTTACCCAGTGGA-3′ and R: 5′-GGACCATGGCTTGACCATCA-3′ GAPDH F: 5′-GAGAGTGTTTCCTCGTCCCG-3′ and R: 5′-ATGAAGGGGTCGTTGATGGC-3′.

Jin W.J., Kim B., Kim D., Park Choo H.Y., Kim H.H., Ha H, & Lee Z.H. (2017). NF-κB signaling regulates cell-autonomous regulation of CXCL10 in breast cancer 4T1 cells. Experimental & Molecular Medicine, 49(2), e295-.

+ Open protocol

+ Expand

Placental Gene Expression in Preeclampsia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total placental RNA was isolated from the placental tissues of 14 normal pregnancies and 13 pregnancies complicated by preeclampsia. Only chorionic tissue from the central part of the placenta, close to the center of the insertion of the umbilical cord, was collected and contamination with maternal decidua and amniotic membranes was excluded by morphological observation. Tissues were frozen in liquid nitrogen and stored at −80°C until extraction of total RNA was performed using the E.Z.N.A.Total RNA kit (Omega Bio-Tek, Norcross, USA). For the removal of DNA contaminants, 2 µg RNA was incubated with 1 U/µl DNase I (Invitrogen, Karlsruhe, Germany) and 2 µg RNA was used as a template for cDNA synthesis using the SuperScript II pre-amplification system, according to manufacturer instructions (Invitrogen, Life Technologies, CA, USA).
Placental expression of CYP24A, CYP27B, and VDR was assessed using real time PCR and quantified against the β-actin signal. The following primer sequences (sense-antisense) were used for Cyp27B1: ggaaggcgaagaatggcaaagg – tcgcagactacgttgttcagggttc; CYP24A1: tctggaaagggggtctcaagaaaca – accgactcaaaggaacccaacttca; VDR: ggacctgtggcaaccaagactacaa – ttcagtcccacctggaacttgatga; and Actin: catcctcaccctgaagtaccccatc – agccacacgcagctcattgtagaag. Fold change was calculated by normalizing to the mean gene expression of healthy controls.

Lechtermann C., Hauffa B.P., Herrmann R., Schündeln M.M., Gellhaus A., Schmidt M, & Grasemann C. (2014). Maternal Vitamin D Status in Preeclampsia: Seasonal Changes Are Not Influenced by Placental Gene Expression of Vitamin D Metabolizing Enzymes. PLoS ONE, 9(8), e105558.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the QIAshredder homogenizer and the RNeasy Mini kit (Qiagen; Venlo, Netherlands) according to the manufacturer's protocol. One microgram of total RNA was used for random hexamer‐primed cDNA synthesis using a Super Script II pre‐amplification system (Invitrogen). Quantitative RT‐PCR reactions were performed in triplicate using iQ5 (Bio‐Rad) and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA) and 300 nM of each of the primers. The primers were designed based on the sequences in the GenBank database. The primer pairs used for this study are shown in Table 1. Electrophoretic separation on a 2.5% agarose gel was performed to ensure accurate outcomes of the reactions.

Takayama K., Kawakami Y., Lavasani M., Mu X., Cummins J.H., Yurube T., Kuroda R., Kurosaka M., Fu F.H., Robbins P.D., Niedernhofer L.J, & Huard J. (2016). mTOR signaling plays a critical role in the defects observed in muscle‐derived stem/progenitor cells isolated from a murine model of accelerated aging. Journal of Orthopaedic Research, 35(7), 1375-1382.

+ Open protocol

+ Expand

Evaluating Osteogenic Gene Expression in hPDLSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

We utilized RT-qPCR to evaluate the expression of osteogenesis-related genes in hPDLSCs (22 (link),23 (link)). Briefly, cells (1×10⁶) were cultured in a 60-mm culture dish for 2 weeks under differentiation induction conditions, and RNA was isolated from the treated cells using an RNeasy Mini kit (Qiagen) according to the manufacturer's instructions. Next, cDNA was synthesized from 2 µg of total RNA using reverse transcriptase (Superscript II Preamplification System; Invitrogen; Thermo Fisher Scientific, Inc.). SYBR-Green PCR Master Mix (ABI Prism 7500; Applied Biosystems; Thermo Fisher Scientific, Inc.) was used for RT-qPCR. The experiment conditions were as follows: 40 cycles of denaturation for 15 sec at 95°C and 1 min of amplification at 60°C. All reactions were run in triplicate, and normalized to the housekeeping gene hypoxanthine-guanine phosphoribosyl transferase (HPRT). The cycle threshold values were calculated and compared to assess gene expression levels in control and gondre-treated groups. The relative mRNA expression levels in hPDLSCs and their gondre-treated counterparts were plotted in a histogram. We evaluated the expression levels of collagen 1 (Col1), runt-related transcription factor 2 (Runx2), bone sialoprotein (BSP), and alkaline phosphatase (ALP) and HPRT. The specific primer sets used for this analysis are listed in Table I.

Dutta S.D., Patel D.K., Jin B., Choi S.I., Lee O.H, & Lim K.T. (2021). Effects of Cirsium setidens (Dunn) Nakai on the osteogenic differentiation of stem cells. Molecular Medicine Reports, 23(4), 264.

+ Open protocol

+ Expand

Differentiation-Induced Gene Expression Analysis in hMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA preparation and real-time PCR was performed as earlier reported by our group [26 (link)]. For this, 1.0 × 10⁶ cells were incubated in a 6 mm culture dish for 7 and 14 days under differentiation media. The RNeasy Mini Kit (Qiagen, Valencia, CA, USA) was utilized to prepare the RNA as per manufacturer's instruction to synthesis the cDNA through reverse transcriptase (Superscript II Preamplification System, Invitrogen, Gaithersburg, MD, USA). The real-time PCR was accomplished with SYBR Green PCR Master Mix (ABI Prism 7500 sequence detection system; Applied Biosystems, Warrington, UK) with the reaction conditions 40 cycles for 15 s of denaturation at 95°C and 1 min of amplification at 60°C. All experiments were implemented in triplicate fashion and normalized it with housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT). The relative RNA expression levels in hMSCs from control and G. frondosa treated samples were compared in a histogram. The expression levels of ALP, BSP, OPN, OCN, COL1, OSX, and RUNX2 were evaluated. The specific primer sets used for this analysis are given in Supplementary .

Patel D.K., Seo Y.R., Dutta S.D., Lee O.H, & Lim K.T. (2020). Influence of Maitake (Grifola frondosa) Particle Sizes on Human Mesenchymal Stem Cells and In Vivo Evaluation of Their Therapeutic Potential. BioMed Research International, 2020, 8193971.

+ Open protocol

+ Expand

Osteoblast Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary osteoblasts (4×10⁵/well) were cultured in 6-well tissue culture plates with or without 4T1-CM (30%) in the presence of DMSO or αTP-suc (10 µM). After 24 hr of culture, cells were harvested for real-time PCR analysis and the culture medium was collected for enzyme-linked immunosorbent assay (ELISA). Total RNA was prepared by using the RNeasy mini kit (Qiagen, Valencia, CA, USA), and cDNA was synthesized from 2 mg of total RNA by use of reverse transcriptase (Superscript II Preamplification System; Invitrogen). Real-time PCR was performed as described previously.[13 (link)] The primers were as follows: for mouse RANKL, (sense) TGGAAGGCTCATGGTTGGAT and (antisense) CATTGATGGTGAGGTGTGCA; for mouse osteoprotegerin (OPG), (sense) TGGAACCCCA-GAGCGAAACA and (antisense) GCAGGAGGCCAAATGTGCTG; for mouse b-actin, (sense) ATGTGGATCAGCAAG-CAGGA and (antisense) AAGGGTGTAAAACGCAGCTC.

Kim B., Kim H.H, & Lee Z.H. (2018). α-Tocopheryl Succinate Inhibits Osteolytic Bone Metastasis of Breast Cancer by Suppressing Migration of Cancer Cells and Receptor Activator of Nuclear Factor-κB Ligand Expression of Osteoblasts. Journal of Bone Metabolism, 25(1), 23-33.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!