Starmag 96 virus kit

Three different automated systems were used for the nucleic acid extraction. QIAcube system (Qiagen, Hilden, Germany) with QIAamp MinElute Virus Spin Kit (Qiagen), EZ1 Advanced XL system (Qiagen) with EZ1 Advanced XL Virus Mini kit v2.0 (Qiagen), and MICROLAB Nimbus IVD system (Hamilton, Reno, NV, USA) with STARMag96 Virus kit (Seegene, Seoul, Korea) were evaluated. Three aliquot samples were separated from each of the specimens, and nucleic acid of each aliquot samples was extracted on the same day by three different automated systems in a single laboratory. The sample and elution volumes used in this study were 150 μL and 60 μL for the QIAcube system, 400 μL and 60 μL for the EZ1 Advanced XL system, and 600 μL and 100 μL for the MICROLAB Nimbus IVD system, respectively. For the quality control of the entire nucleic acid extraction process and RT-PCR, 10 μL of bacteriophage MS2 (AnyplexTMII RV16 detection, Seegene) was added to each sample as the internal control in order to check the entire process from nucleic acid extraction to PCR. cDNA was synthesized using the cDNA Synthesis Premix (Seegene) which included reverse transcriptase and a random hexamer, according to the manufacturer's protocol.

The viral nucleic acids from the collected nasopharyngeal swab specimens were extracted using the LaboPass^TM Labozol reagent (CosmoGenetech, Seoul, South Korea)/STARMag 96 Virus kit (Seegene Inc., Seoul, Korea). The extracted RNA was reverse-transcribed into cDNA using a LaboPassTM cDNA synthesis kit (CosmoGenetech)/cDNA Synthesis Automix (Seegene). Target gene-specific primer pairs (5′–3′) were as follows: G151–173F: CTGGCAATGATAATCTCAACTTC, F3–22R: CAACTCCATTGTTATTTGC [17 (link)]. The PCR product was amplified using the following process: initial denaturation for 5 min at 95°C, 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and a final extension step at 75°C for 5 min. The amplified products were separated by electrophoresis on 1–1.5% agarose gel and purified using a LaboPass™ Gel Extraction Kit (CosmoGenetech)/ Millipore plate MSNU030 (Millipore SAS, Molsheim, France). The purified PCR products were subjected to Sanger sequencing using a BigDye Terminator v3.1 sequencing kit and a 3730xl automated sequencer (Applied Biosystems, Foster City, CA).