Megascript t7 kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, Lithuania

The MEGAscript T7 kit is a powerful tool for in vitro transcription of RNA. It utilizes the T7 RNA polymerase to efficiently generate large quantities of RNA from DNA templates. The kit provides the necessary reagents and instructions to perform this process.

Automatically generated - may contain errors

Lab products found in correlation

540 protocols using megascript t7 kit

In Vitro Transcription of DVG and RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

DVG-expressing plasmids were linearized and in vitro transcribed with the MEGAscript T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas). RNA products were treated with DNase and then precipitated with LiCl. The optical density at 260 nm (OD₂₆₀)/OD₂₈₀ ratios of all ivtDVGs were between 2.00 and 2.25, and the OD₂₆₀/OD₂₃₀ ratios were between 2.20 and 2.60. Purified PCR products were used for in vitro transcription of poly(U/UC) or X region RNA with the MEGAscript T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas).

Xu J., Mercado-López X., Grier J.T., Kim W.K., Chun L.F., Irvine E.B., Del Toro Duany Y., Kell A., Hur S., Gale M J.r., Raj A, & López C.B. (2015). Identification of a Natural Viral RNA Motif That Optimizes Sensing of Viral RNA by RIG-I. mBio, 6(5), e01265-15.

+ Open protocol

+ Expand

Generation of DENV-Luc Infectious Clones

Check if the same lab product or an alternative is used in the 5 most similar protocols

DENV-Luc infectious clone containing adapted mutations were generated by PCR amplification from WT DENV-Luc infectious clone plasmid (gift from Jan Carette). For DENV-Luc(A6665G) fragments were amplified using GAAGAGTGATGGTTATGGTAGGC/CTGTATTTGTGCGCACCATAGGAGGATG and CATCCTCCTATGGTGCGCACAAATACAG/GTGATCTTCATTTAAGAATCCTAGGGCTTC. For DENV-Luc(A7558T) fragments were amplified using GAAGAGTGATGGTTATGGTAGGC/CCCCTTCTTGTGTAGGTTGTGTTCTTC and GAAGAACACAACCTACACAAGAAGGGG/GTGATCTTCATTTAAGAATCCTAGGGCTTC.
For DENV-Luc(A6665G, A7558T) fragments were amplified using GAAGAGTGATGGTTATGGTAGGC/CTGTATTTGTGCGCACCATAGGAGGATG, CATCCTCCTATGGTGCGCACAAATACAG/CCCCTTCTTGTGTAGGTTGTGTTCTTC, and GAAGAACACAACCTACACAAGAAGGGG/GTGATCTTCATTTAAGAATCCTAGGGCTTC. PCR products were cloned into NarI and AvrII cut WT DENV-Luc infectious clone using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) and transformed into Stbl3 bacteria (Berkeley MacroLabs). Constructs were verified by Sanger sequencing. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production. Supernatants were harvested 6–9 days post-transfection.

Ngo A.M., Shurtleff M.J., Popova K.D., Kulsuptrakul J., Weissman J.S, & Puschnik A.S. (2019). The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins. eLife, 8, e48469.

+ Open protocol

+ Expand

Knockdown and Knockout Experiments for Fzd4 in Xenopus

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For knockdown experiments, antisense HNF1β-MO (CCTCGCTGTGAACAAAA CACAAA; 25 ng/embryo for WMISH/qPCR and 55 ng/embryo for explants), control-MO (CCTCTTACCTCAGTTACAATTTATA; same amounts as for HNF1β-MO), Fzd4/Fzd4s-MO (Gorny et al., 2013 (link); ATTATTCTTCTTCTGTTGCCG CTGA; 5 ng/embryo for WMISH/qPCR and 45 ng/embryo for explants) and Fzd4-mismatch-MO (ATTATTaTTaTTCTaTTGCaGCTaA; same amounts as for Fzd4/Fzd4s-MO). For knockout experiments using CRISPR/Cas, 3 ng/embryo capped sense RNA of Cas9 (Blitz et al., 2013 (link)), prepared by Acc651 linearisation and transcribed with the mMessage mMachine T7 kit (Ambion), was injected animally at the one-cell stage alone or together with 300 pg/embryo uncapped sense Fzd4-gRNA, linearised with DraI and transcribed with a MEGAscript T7 kit (Invitrogen). Fzd4-gRNA was generated by cloning the oligonucleotides 5′phosp-TAGGCACATGGTGATCCTGATG and 5′phosp-AAACCATCAGGATCACCATGTG into pDR274 (Addgene). For target- and predicted potential off-target (CRISPR/Cas Target online predictor; CCTop; Stemmer et al., 2015 (link)) mutation analysis, genomic DNA from 50 explants, per condition and biological replicate, was isolated by using a ‘DNeasy Blood and Tissue Kit’ (Qiagen). The region around the target site and predicted off-target sites was amplified and cloned into the pGem^®-T Easy vector (Promega) for sequence analysis.

Gere-Becker M.B., Pommerenke C., Lingner T, & Pieler T. (2018). Retinoic acid-induced expression of Hnf1b and Fzd4 is required for pancreas development in Xenopus laevis. Development (Cambridge, England), 145(12), dev161372.

+ Open protocol

+ Expand

Designing and Validating T. castaneum dsRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed the T. castaneum cactus primer sequences for dsRNA synthesis from the iBeetle Database [30 (link)] (Table I in S1 Tables). We then verified the primer pair for the absence of secondary effects by comparing phenotypes with a non-overlapping dsRNA fragment [30 (link)] and by blasting the primer pair against the new T. castaneum genome using NCBI’s Primer-BLAST [85 (link)]. Next, we generated T7 promoter sequence-tagged DNA from T. castaneum cDNA via PCR using the Platinum Green Hot Start kit (Invitrogen). We then purified the PCR product using the QIAquick PCR Purification kit (Qiagen). Using the Megascript T7 kit (Invitrogen), we synthesized dsRNA overnight [76 (link)]. As a control for the induction of beetle RNAi, we used E. coli DNA as a template to produce dsRNA against a maltose binding protein E (malE) sequence [58 (link)]. Finally, we quantified dsRNA concentration using the Qubit microRNA Assay Kit (Invitrogen).

Critchlow J.T., Prakash A., Zhong K.Y, & Tate A.T. (2024). Mapping the functional form of the trade-off between infection resistance and reproductive fitness under dysregulated immune signaling. PLOS Pathogens, 20(2), e1012049.

+ Open protocol

+ Expand

Generating Gene-Specific Riboprobes for In Situ Hybridization

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNAs encoding gene-specific sequences flanked with a T7 promoter were amplified using the PCR primers shown in S1 Table. Digoxigenin-labeled RNA probes (approximately 500–1100 bases long) were then in vitro transcribed from these PCR products using a MEGAscript T7 Kit (Invitrogen). Whole-mount in situ hybridizations were performed according to standard protocols [32 (link)].

Ouyang X., Panetta N.J., Talbott M.D., Payumo A.Y., Halluin C., Longaker M.T, & Chen J.K. (2017). Hyaluronic acid synthesis is required for zebrafish tail fin regeneration. PLoS ONE, 12(2), e0171898.

+ Open protocol

+ Expand

In vitro Transcription of pri-miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pri-miRNAs were synthesized by in vitro transcription (IVT) in 20 μl reaction mixture containing 200 ng double-stranded DNA (dsDNA) templates using the MEGAscript T7 Kit (Invitrogen, AMB13345). The DNA templates were prepared by PCR using the primers shown in Supplementary Table S2. The PCR templates are either the genomic DNAs or the pri-miRNA-containing vectors. The IVT mixture was incubated at 37°C overnight. The reaction was then stopped by the addition of 20 μl 2× TBE-Urea sample buffer (20 mM Tris–HCl (pH 7.5), 20 mM EDTA, 8 M Urea), and heating to 75°C for 5 min. The RNAs were then separated by 10% Urea-PAGE. The RNAs were gel-eluted overnight, precipitated by the addition of isopropanol, washed with 80% ethanol, dried, and finally dissolved in distilled water. The RNA concentration was measured using a Nanodrop spectrophotometer, and the RNA quality was assessed by 10% urea–PAGE before usage. The purified RNAs were stored at −80°C.

Nguyen T.L., Nguyen T.D., Bao S., Li S, & Nguyen T.A. (2020). The internal loops in the lower stem of primary microRNA transcripts facilitate single cleavage of human Microprocessor. Nucleic Acids Research, 48(5), 2579-2593.

+ Open protocol

+ Expand

Synthesis of Capped RNA Reporters

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Capped RNA reporters were synthesized using the Megascript T7 kit (Invitrogen). The RLuc and FLuc reporters were amplified by PCR to introduce a 72 nt long polyA at the end of the transcript using a poly(d)T-tailed reverse primer. PCR product were gel purified and used as templates for the in vitro transcription reactions in the presence of cap as described previously^{12 (link)}. All the in vitro transcribed reporters contain the CG43674 5′UTR.

Acevedo J.M., Hoermann B., Schlimbach T, & Teleman A.A. (2018). Changes in global translation elongation or initiation rates shape the proteome via the Kozak sequence. Scientific Reports, 8, 4018.

+ Open protocol

+ Expand

DENV Replicon RNA Electroporation Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DENV replicon plasmid (Marceau et al., 2016 (link)) was linearized using XbaI restriction enzyme. Replicon RNA was generated using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation. For electroporation, 2 million WT or EMC4 KO HEK293FT cells were washed twice in PBS, resuspended in 100 μl SF Nucleofector solution (Lonza), mixed with 4 μg replicon RNA, transferred to a 100 ul nucleocuvette and pulsed using program CM-130 on an Amaxa 4D-Nucleofector X Unit (Lonza). Cells were then resuspended in antibiotic-free medium, distributed into 96-wells and lysed at different timepoints post-electroporation using Renilla Lysis buffer. Luminescence was measured using Renilla Luciferase Assay system (Promega) on a Spectramax i3x Multi-Mode Microplate Reader (Molecular Devices).

+ Open protocol

+ Expand

Fluorescent DNA Oligonucleotide Synthesis and RNA Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

All fluorescently labeled DNA oligonucleotides were HPLC-purified and obtained from IBA-GmBh (Germany) and IDT (Coralville, IA). Unlabeled DNA oligonucleotides were purchased from IDT. RNA was transcribed in vitro using a MEGAscript T7 Kit (Invitrogen, USA). geneBlock fragments were obtained from IDT.
Sequences of the various oligonucleotides used are listed in table in Supplementary file 1.

Chakraborty K., Anees P., Surana S., Martin S., Aburas J., Moutel S., Perez F., Koushika S.P., Kratsios P, & Krishnan Y. (2021). Tissue-specific targeting of DNA nanodevices in a multicellular living organism. eLife, 10, e67830.

+ Open protocol

+ Expand

Passage and Propagation of Infectious Viruses

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was transcribed from the infectious clones using the MEGAscript T7 kit (Invitrogen). Infectious RNA was electroporated using a Bio-Rad Gene PulsarTM (two pulses at 0.75 kV and 25 mF) or transfected into BHK-21 cells (clone 13). After 24 h, the cells were frozen then thawed in their growth media. Following clarification by centrifugation, the supernatant containing the initial virus stock (termed ‘passage 0’, P0) was harvested. Foetal goat tongue (ZZ-R 127) or BHK-21 cells were subsequently used to passage the viruses 44 (link). Cells were infected for 24 h between passages. The yields of wild-type and mutant viruses were similar. BHK-21 cells (clone 13) have been maintained in the Pirbright institute since 1965. ZZ_R 127 cells were a gift from Bernd Haas Friedrich-Loeffler-Institut, (FLI) Greifswald, Germany. All cell cultures were free of mycoplasma and bovine viral diarrhea virus.

Kotecha A., Seago J., Scott K., Burman A., Loureiro S., Ren J., Porta C., Ginn H.M., Jackson T., Perez-Martin E., Siebert C.A., Paul G., Huiskonen J.T., Jones I.M., Esnouf R.M., Fry E.E., Maree F.F., Charleston B, & Stuart D.I. (2015). Structure-based energetics of protein interfaces guide Foot-and-Mouth Disease virus vaccine design. Nature structural & molecular biology, 22(10), 788-794.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!