EARLI study staff were present at each delivery. Umbilical cord blood and placenta biosamples were collected shortly after delivery using standardized protocols, implemented across all sites. Placental biopsy samples from the fetal side of the placenta were collected at each clinical site using Baby Tischler Punch Biopsy Forceps. Sample punches were stored at ambient temperature in RNAlater vials (Qiagen, Cat. No. 76154) and shipped same-day to the Johns Hopkins Biological Repository (JHBR) in Baltimore, Maryland, for storage at −190°C until further processing. Umbilical cord blood samples were collected into EDTA tubes and shipped same-day with a cold pack to JHBR for storage at −80°C. Genomic DNA was extracted from both fetal placenta and cord blood samples at JHBR using a QIAgen QIAsymphony automated workstation with the DSP DNA Midi kit (Cat. No. 937255), as specified by the manufacturer. Genomic DNA was quantified using a NanoDrop spectrophotometer (ThermoFisher Scientific).
Dsp dna midi kit
Manufactured by Qiagen
Sourced in Germany
The DSP DNA Midi kit is a laboratory equipment product designed for the purification of DNA. It is used to extract and purify DNA samples from a variety of sources. The kit provides a standardized and efficient process for DNA isolation and preparation, suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Qiasymphony, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
Qiaamp ucp dna micro kit, by Qiagen (1 mentions)
Magna lyser, by Roche (1 mentions)
Taqman snp assay, by Thermo Fisher Scientific (1 mentions)
Quick gdna blood kit, by Zymo Research (1 mentions)
Bcl2fastq tool, by Illumina (1 mentions)
Hiseq x sequencing system, by Illumina (1 mentions)
Miseq platform, by Illumina (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
8 protocols using dsp dna midi kit
1
Placental and Umbilical Cord Biosampling
2
Genomic DNA Isolation and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was isolated from organoids using the QIAamp UCP DNA micro kit (QIAGEN). In short, organoids were collected in AdvDF+++ and centrifuged for 5 min at ×750 g, 4°C. The organoid pellet was further processed according to the manufacturer's instructions. Human genomic DNA was isolated from EDTA blood using the DSP DNA midi kit (QIAGEN). Targeted mutation analysis of 31 cancer‐related genes (TableS2 ) was performed using the single‐molecule molecular inversion probes technique.34 Sequence data were analysed using SeqNext software from JSI. Validation of conservation of KRAS and TP53 mutations across organoids and the parent tumour was done by analysing total genomic DNA extracted from formalin‐fixed paraffin‐embedded tumour sections using the QIAamp DNA FFPE Tissue Kit (QIAGEN) according to the manufacturer's instructions. Extracted genomic DNA was amplified by PCR using the following primers: KRAS‐exon2: FW 5′‐GATACACGTCTGCAGTCAACTG‐3′, RV 5′‐GGTCCTGCACCAGTAATATGC‐3′; TP53‐exon5: FW 5′‐GCCCTGACTTTCAACTCTGTCTC‐3′, RV 5′‐CATCGCTATCTGAGCAGCGC‐3′; TP53‐exon6: FW 5′‐GCGCTGCTCAGATAGCGATG‐3′, RV 5′‐CCCAGTTGCAAACCAGACCTC‐3′. Purified amplicons were sequenced by Eurofins Genomics (Germany).
3
DNA Extraction from Frozen Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were retrieved from the −80 °C samples for DNA isolation. A maximum of 250 mg of the sample was pre-treated prior to automated DNA extraction. Sample was submitted to mechanical lysis with 1.4 mm glass beads during two 60 sec cycles at 6400 rpm on a MagNA Lyser instrument (Roche, Mannheim, Germany) and enzymatic lysis with proteinase K. The remainder of the extraction process was automated on QIAsymphony with the DSP DNA midi kit (Qiagen, Hilden, Germany) with protocol VB400 default IC. Non-template DNA isolation control performed by passing PCR-grade water through the same extraction process was included. DNA extracts were stored at −20 °C until amplification.
4
CYP2B6 Genotyping from Whole Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole blood samples for CYP2B6 genotyping were analyzed as previously described [11 (link)]. Genomic DNA was extracted from 400 L whole blood collected in EDTA using the DSP DNA Midi Kit in combination with the QiaSymphony automated system (QIAGEN, Valencia, CA, USA). Samples were stored at -20°C until analysis. Each sample was genotyped for the CYP2B6 516G>T (rs3745274), 785A>G (rs2279343), 983T>C (rs28399499) and 1459 C>T (rs3211371) single nucleotide polymorphism (SNP). Genotyping was performed using Agena iPLEX (Agena San Diego, CA, USA) and validated on the Coriell SNP 500 DNA set and CEPH trios, at the Genomics Shared Resource at Roswell Park Comprehensive Cancer Center in Buffalo, NY. Primer sequences were designed as previously described [11 (link)]. Analysis of the SNPs permitted the detection of CYP2B6*1, CYP2B6*4 (785A>G), CYP2B6*5 (1459C>T), CYP2B6*6 (516G>T, 785A>G), CYP2B6*7 (516G>T, 785A>G, 1459C>T), CYP2B6*9 (516G>T), CYP2B6*16 (785A>G, 983T>C) and CYP2B6*18 (983T>C) alleles. Based on an individual’s CYP2B6 genotype, a metabolizing phenotype status was determined as follows: normal function: *1/*1, *1/*5, *1/*7; LOF: *1/*6, *1/*18, *6/*16, *6/*6; and gain of function: *1/*4, *4/*6 [40 (link)].
5
APOE Genotyping from Buffy Coats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Buffy coats were prepared from whole blood collected at the follow-up survey in 2012. DNA was purified from buffy coats using a QIA symphony DSP DNA Midi Kit (QIAGEN, Hilden, Germany) and stored at –80°C. Using TaqMan® SNP Assays (Life Technologies, Carlsbad, CA), single nucleotide polymorphism genotyping of the APOEɛ4 allele (rs429358) was conducted. Individuals with at least one ɛ4 allele were determined as APOEɛ4 allele-positive carriers.
6
DNA Isolation from Blood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the samples of the discovery phase, DNA was isolated from white blood cells using Qiagen Autopure kit with glycogen according to the manufactures protocol. DNA quantity was measured using Qubit Fluorometric Quantitation before sequencing. DNA was isolated from the blood samples of the German and Dutch validation cohort using respectively Quick gDNA Blood kit (Zymo Research) and DSP DNA Midi Kit (Qiagen; ref: 937255) according to the manual.
7
FFPE Neuroblastoma Shallow Whole Genome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Shallow whole genome sequencing was performed on FFPE material of the neuroblastoma as described before [26] . DNA from a whole blood sample was isolated using the DSP DNA Midi kit according to manufacturer's protocol (Qiagen, Venlo, The Netherlands). Library preparation and sequencing were performed on the HiSeqX sequencing system (Illumina, San Diego, CA, USA), the BCL output was converted using the bcl2fastq tool (Illumina, v.2.20, San Diego, CA, USA) as described before [27] . For analysis and visualization, the "R2: Genomics Analysis and Visualization Platform (http://r2.amc.nl)" was used.
8
Comprehensive mtDNA Analysis from Various Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from a skeletal muscle, hair, urine and buccal samples by proteinase K digestion and a DNeasy Blood and Tissue Kit (Qiagen); DNA isolation from blood was performed using a DSP DNA Midi kit (Qiagen). Large-scale mtDNA rearrangements were analyzed by long-range PCR protocols [8] (link) . Sequencing of the entire mitochondrial genome in muscle, including both detection and quantification of variants, was performed by next generation sequencing using a MiSeq platform (Illumina) exactly as reported [8] (link) . Assessment of m.4414T > C heteroplasmy levels in the blood, hair, buccal and urine DNA was also performed by next generation sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!