Potato dextrose broth (pdb)

Manufactured by HiMedia

Sourced in India, Germany, United States

Potato dextrose broth is a culture medium used for the growth and isolation of various fungi, particularly yeasts and molds. It provides the necessary nutrients and conditions for the cultivation of these microorganisms.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Dextrose (17 citations)

72 protocols using potato dextrose broth (pdb)

Antifungal Potential of B. contaminans

Check if the same lab product or an alternative is used in the 5 most similar protocols

The phytopathogenic fungi M. phaseolina was obtained from the Bangladesh Jute Research Institute (BJRI), Dhaka. Nigrospora sphaerica, Xylaria spp., Aspergillus fumigatus, Aspergillus niger, and Penicillium oxalicum were collected from the Molecular Biology Lab, Department of Biochemistry and Molecular Biology, University of Dhaka. Rhizoctonia solani was obtained from the Bangladesh Agricultural University, Mymensingh, Bangladesh. All the fungi were grown and maintained on potato dextrose agar (PDA) and for GC-MS analysis, M. phaseolina was grown in potato dextrose broth (PDB) (HiMedia, India) at 28°C. The antagonistic bacterial strain was isolated from jute seed as an endophytic bacterium as described by Coombs and Franco [22 (link), 23 (link)] and identified as B. contaminans by 16S rRNA. Bacterial subculture was maintained on Tryptone Soy Agar (TSA) (HiMedia, India).
Jute seedlings were used to assess plant growth promotion activity of B. contaminans NZ. Fresh seeds of a jute variety (Corchorus olitorius var. O-4) were collected from BJRI. All tests were performed in triplicate if not mentioned otherwise.

Zaman N.R., Chowdhury U.F., Reza R.N., Chowdhury F.T., Sarker M., Hossain M.M., Akbor M.A., Amin A., Islam M.R, & Khan H. (2021). Plant growth promoting endophyte Burkholderia contaminans NZ antagonizes phytopathogen Macrophomina phaseolina through melanin synthesis and pyrrolnitrin inhibition. PLoS ONE, 16(9), e0257863.

+ Open protocol

+ Expand

Cultivation and Preparation of Fonsecaea Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

The strains F. pedrosoi ATCC 46428, F. pedrosoi CBS 271.37, F. erecta CBS 125763 and F. monophora CBS 102248 were selected for this study. The yeast strains were grown on Sabouraud Glucose Agar (SGA; Himedia, Mumbai, India) at 28°C for 7 days, transferred to Potato Dextrose Broth (PDB; Himedia) and incubated under agitation (150 rpm) at 37°C. After 5 days, the cultures were allowed to settle in order to decant the larger particles such as hyphae and conidia. Fungal cells were separated by filtration through a 40 μm cell strainer, (BD) washed with PBS 1 × three times. Finally, the cells were re-suspended at 1 × 10⁶ cells/mL for F. pedrosoi ATCC 46428, F. pedrosoi CBS 271.37, and F. erecta CBS 125763, or at 1 × 10⁵ cells/mL for F. monophora CBS 102248.

Vicente V.A., Weiss V.A., Bombassaro A., Moreno L.F., Costa F.F., Raittz R.T., Leão A.C., Gomes R.R., Bocca A.L., Fornari G., de Castro R.J., Sun J., Faoro H., Tadra-Sfeir M.Z., Baura V., Balsanelli E., Almeida S.R., Dos Santos S.S., Teixeira M.D., Soares Felipe M.S., do Nascimento M.M., Pedrosa F.O., Steffens M.B., Attili-Angelis D., Najafzadeh M.J., Queiroz-Telles F., Souza E.M, & De Hoog S. (2017). Comparative Genomics of Sibling Species of Fonsecaea Associated with Human Chromoblastomycosis. Frontiers in Microbiology, 8, 1924.

+ Open protocol

+ Expand

Monoconidial culture DNA extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the monoconidial cultures were grown in triplicate in Potato Dextrose Broth (PDB) (HiMedia, Mumbai, India) at 28 °C in a shaking incubator with 180 rpm and a 12 h photoperiod. After five days, the mycelia were harvested, crushed, and DNA was isolated using the Qiagen Miniprep DNA isolation kit (Qiagen, Hilden, Germany). The extracted DNA was quantified using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Genomic DNAs from all the monoconidial cultures were subjected to PCR using the internal transcribed spacer (ITS) primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) [21 ]. The amplified products were sequenced using Sanger sequencing and the isolates were confirmed to be B. sorokiniana by analyzing the sequences using the Unite ITS database (https://unite.ut.ee/; accessed on 26 May 2021).

Yadav S., Raazi Z., Shivaraj S.M., Somani D., Prashant R., Kulkarni A., Kumar R., Biradar S., Desai S, & Kadoo N. (2022). Whole Genome Sequencing and Comparative Genomics of Indian Isolates of Wheat Spot Blotch Pathogen Bipolaris sorokiniana Reveals Expansion of Pathogenicity Gene Clusters. Pathogens, 12(1), 1.

+ Open protocol

+ Expand

Antimicrobial Compound Screening Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

DES 98%, dimethyl sulfoxide
(DMSO), ascorbic acid, DPPH, and LC–MS grade methanol, acetonitrile,
and HPLC water were purchased from Sigma-Aldrich; amphotericin B,
ciprofloxacin, streptomycin sulfate, 70% ethanol, formic acid (LC–MS
grade), PDA, and potato dextrose broth (PDB) were procured from HiMedia
Laboratories, India.

Abrol V., Kushwaha M., Arora D., Mallubhotla S, & Jaglan S. (2021). Mutation, Chemoprofiling, Dereplication, and Isolation of Natural Products from Penicillium oxalicum. ACS Omega, 6(25), 16266-16272.

+ Open protocol

+ Expand

Antimicrobial Activity of Ulvan

Check if the same lab product or an alternative is used in the 5 most similar protocols

Six Gram-positive bacterial pathogens (Streptococcus agalactiae, Staphylococcus aureus ATCC 25,923, Enterococcus faecalis ATCC 29,212, Bacillus Subtilis ATCC 6633, Staphylococcus epidermidis, and Listeria monocytogenes ATCC 35,152), as well as six Gram-negative bacterial strains (Aeromonas hydrophila, Pseudomonas fluorescens, Pseudomonas aeruginosa ATCC 9027, Escherichia coli ATCC 8739, Klebsiella pneumonia ATCC 13,883, and Bordetella pertussis ATCC 8467), were used as reference strains. In addition, three fungal strains (Aspergillus niger, Penicillium notatum, and Fusarium solani) and one yeast strain, Candida albicans ATCC 10,231, were used. The Microbiology Laboratory provided the strains (National Institute of Oceanography and Fisheries, Alexandria, Egypt). Four media were used to cultivate the reference strains and to detect the antimicrobial activity of ulvan [13 (link)]. They were nutrient broth (NB) (Oxoid, USA) and nutrient agar (NA) (Oxoid, USA) for bacteria and yeast, potato dextrose broth (PDB) (HiMedia, India), and potato dextrose agar (PDA) (HiMedia, India) for fungi.

Ibrahim M.I., Amer M.S., Ibrahim H.A, & Zaghloul E.H. (2022). Considerable Production of Ulvan from Ulva lactuca with Special Emphasis on Its Antimicrobial and Anti-fouling Properties. Applied Biochemistry and Biotechnology, 194(7), 3097-3118.

+ Open protocol

+ Expand

Optimizing Extracellular Polysaccharide Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Potato Dextrose Broth (PDB) (HiMedia, New Delhi) containing 2.4 g/100 mL of dextrose was modified with different combinations of the independent variables (pH, sucrose, and ammonium sulfate concentrations), following the experimental design. The ranges of the pH value, sucrose, and ammonium sulfate concentrations investigated were specified as 2-6, 1-5 (g/100 mL) and 4-12 (g/100 mL), respectively. All experiments were conducted in 250 mL Erlenmeyer flasks containing 90 mL of the growth medium. After inoculation, the flasks were incubated with shaking at 150 rpm in the dark for 5 days at 25 • C. The sucrose was added in addition to the dextrose which present in PDB, since sucrose has reported as the preferred carbon source for EPS production [31, (link)32] (link). Furthermore, most microorganisms have been reported to use ammonium salts or amino acids as nitrogen sources for polysaccharide production [33] , and several studies had previously demonstrated the sufficiency of the use of ammonium sulfate to achieve optimal EPS yields [23, (link)34] (link). Therefore, ammonium sulfate was selected as the preferred nitrogen source.

Okoro O.V., Gholipour A.R., Sedighi F., Shavandi A., & Hamidi M. (2021). Optimization of Exopolysaccharide (EPS) Production by Rhodotorula mucilaginosa sp. GUMS16. ChemEngineering, 5(3), 39-39.

+ Open protocol

+ Expand

Pythium aphanidermatum Strain Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The phytopathogen Pythium aphanidermatum strain 3482 was procured from NFCCI (National Fungal Culture Collection of India), Agharkar Research Institute, Pune, India. It was stored as microconidial suspensions in 30% glycerol at -80°C (Borah et al. 2016) . Potato dextrose agar (PDA; HiMedia) plates and Potato dextrose broth (PDB; HiMedia) at 4°C were used to maintain the working cultures which were subcultured every 2 weeks.

Goswami D., & Syiem M.B. (2021). Biocontrol of Pythium aphanidermatum causing soft rot in ginger with biosurfactant produced by a rhizospheric Bacillus species. Journal of Spices and Aromatic Crops.

+ Open protocol

+ Expand

Harzianic Acid Purification from Trichoderma

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Harzianic acid was obtained from T. harzianum M10 grown in liquid medium (PDB, HiMedia, Mumbai, India) for 21 days and purified following a previously described protocol with some modifications [25 (link)]. Briefly, culture filtrate was exhaustively extracted with ethyl acetate (EtOAc, Carlo Erba, Cornaredo, Milan, Italy), and the dry residue was resuspended in dichloromethane (DCM, Carlo Erba) and extracted with a 2M solution of sodium hydroxide (NaOH, Carlo Erba). The aqueous phase was acidified at pH = 2 with hydrochloric acid (HCl, Carlo Erba), and harzianic acid was obtained after vacuum filtration and precipitate wash with EtOAc. Harzianic acid identification was achieved by NMR and LC-MS analyses [30 (link),31 (link)].

Staropoli A., Cuomo P., Salvatore M.M., De Tommaso G., Iuliano M., Andolfi A., Tenore G.C., Capparelli R, & Vinale F. (2023). Harzianic Acid Activity against Staphylococcus aureus and Its Role in Calcium Regulation. Toxins, 15(4), 237.

+ Open protocol

+ Expand

Fungal Isolate Maintenance and Culturing

Check if the same lab product or an alternative is used in the 5 most similar protocols

M. oryzae isolate M-1477 was obtained from Microbial Type Culture Collection, Institute of Microbial Technology, India. Isolates listed in tables 2 and 3 were provided by Dr K. K. Muralidharan, Dr. S. S. Gnanamanickam and Dr. Y. Tosa. The cultures were maintained in potato dextrose broth (PDB; HiMedia) and stored as −80°C glycerol stock. For routine use, fungal culture was maintained on potato dextrose agar (PDA, HiMedia) plates at 4°C. Cultures were routinely manipulated at 25°C. Escherichia coli XL-I-B competent cells were used as a host for plasmids and were grown in Luria-Bertani (LB) medium (Difco). Solid media were made with 1.8% Bacto agar (Difco).

Chadha S, & Sharma M. (2014). Transposable Elements as Stress Adaptive Capacitors Induce Genomic Instability in Fungal Pathogen Magnaporthe oryzae. PLoS ONE, 9(4), e94415.

+ Open protocol

+ Expand

Antifungal Activity of Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

The compounds 8 were tested for antifungal activity by the agar well diffusion
method against the fungal strains C. albicans (MTCC 3958) and A. niger (MTCC 9933).
For the experimental work, a loopful of each strain was grown in the
potato dextrose broth (PDB, HiMedia, India) medium at 28 °C for
4–5 days. Following optimal growth of each fungal strain, 100
μL of culture was uniformly spread on the potato dextrose agar
medium plate. Following adsorption, wells of 6 mm were prepared by
the sterile metallic borer and a solution of the working compound
of different concentrations was poured into the wells. Plates were
incubated at 28 °C for 4–5 days under dark conditions.
The mean diameter of the inhibition zone was measured to determine
antifungal activity. For the MIC assay, sterile test tubes containing
5 mL of sterilized Czapeks Dox broth medium was inoculated with 100
μL of freshly grown culture of each test strain and appropriate
amount of the compound was added to achieve the desired concentrations.
The tubes were incubated at 28 °C for five days under dark conditions
and carefully observed for the presence of turbidity. Amphotericin
B was used as the positive control. The experiment was performed in
duplicate sets.

Nandwana N.K., Singh R.P., Patel O.P., Dhiman S., Saini H.K., Jha P.N, & Kumar A. (2018). Design and Synthesis of Imidazo/Benzimidazo[1,2-c]quinazoline Derivatives and Evaluation of Their Antimicrobial Activity. ACS Omega, 3(11), 16338-16346.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!