T4 ligase

The promoter sequence for cyclin D1 (GeneBank accession No. NM_007631) was identified, and potential binding sites for NF-κB-p65 were found to synthesize primers (cyclin D1 F:ACCATTCCCTTGACTGCCGA R:GGAGGGTGGGTTGGAAATGA). The promoter region was then cloned, purified and migrated into Pmir-GLO-P (TOYOBO) vector using T4 Ligase (TOYOBO). Escherichia coli DH10B was then transformed with the vector, and sequencing was used to identify correct single clones.

Open reading frame(ORF) encoding NSs was amplified by reverse transcription-PCR(RT-PCR) from SFTSV genomic RNA, and two restriction enzymes Xhol and PremI (New England Biolabs, USA) were used to cloned the NSs segment into expression vector pc-DNA3.1 with three tag (Flag, His, StrepII) using T4 ligase (Toyobo, Japan). The primers for SFTSV NSs plasmid construction were: forward: 5’-TTAGACCTCCTTCGGGAGGTCA-3’; reverse: 5’-TGGAGCATTTGCTCAG CGACAT-3’.

The KOD-Plus-Neo DNA polymerase and T4 ligase were obtained from Toyobo (Osaka, Japan). The restriction enzymes and the E. coli SHuffle T7 Express lysY cells were obtained from New England Biolabs Japan (Tokyo, Japan). The oligonucleotides were obtained from Operon-Eurofins (Tokyo, Japan). The PureYield plasmid miniprep kit was obtained from Promega (Tokyo, Japan). The ultrafiltration devices were obtained from Millipore (centrifugal filter tube Ultra-4, MWCO 3 k; Tokyo, Japan). The immobilized Tris(2-carboxyethyl)-phosphine (TCEP) disulfide-reducing gel was obtained from Pierce Biotechnology (Thermo Fisher Scientific, Rockford, IL, USA). ATTO520-C2-maleimide was obtained from the ATTO-TEC (Siegen, Germany). TAMRA-C5-maleimide was obtained from Biotium (Hayward, CA, USA). The Talon resin was obtained from Clontech (Takara-Bio, Shiga, Japan). The His SpinTrap column was obtained from GE Healthcare (Piscataway, NJ, USA). Anti DYKDDDDK-tag antibody beads and the DYKDDDDK peptide were obtained from Wako Pure Chemicals (Osaka, Japan). The recombinant HA protein from A/California/04/2009 H1N1 was obtained from Sino Biological (Beijing, China). Unless otherwise indicated, all other chemicals and reagents used were from Wako Pure Chemicals or Sigma (Tokyo, Japan).