Pcdna3 egfp vector

The MAP3K3 3′UTR was cloned into a pcDNA3/EGFP vector (Shanghai GeneChem Co., Ltd., Shanghai, China) and mutations were introduced at potential miR-505 binding sites. The constructed pcDNA3/EGFP-MAP3K3-3′UTR (0.5 µg) or its mutated form pcDNA3/EGFP- MAP3K3-3′UTR-mut (0.5 µg) were co-transfected with pri-miR-505 (0.5 µg; pri-miR-505-sense, 5′-CGCGGATCCCA GACTCCCAGCAATCAC-3′, pri-miR-505-antisense, 5′-CCG GAATTCGCAGTATTCCCACCATTT-3′), ASO-miR-505 (20 nM; ASO-miR-505, 5′-AGGAAACCAGCAAGUGUU GACG-3′) or their respective control vector (pcDNA3; Vigene Biosciences Inc.) or oligos (ASO-NC, 5′-UCAUCGUAUCA GCUAUAUCGCA-3′) into A549 and H460 cells, and pDsRed2-1 vector (Clontech Laboratories, Inc., Mountainview, CA, USA) also co-transfected for normalization aim in 48-well plates using Lipofectamine 2000 (DNA:Lipofectamine 2000, 1:1). At 48 h post-transfection, the total proteins were extracted by RIPA buffer and the fluorescence intensities of GFP and red fluorescent protein (RFP) were measured. The EGFP activity was measured using a spectrophotometer (cat. no. F4500; Hitachi, Ltd.) at 528 nm. RFP-expressing plasmid was integrated as a transfection efficiency control.

The WNT2B 3′UTR was cloned into a pcDNA3/EGFP vector (Shanghai GeneChem Co., Ltd., Shanghai, China) and mutations were introduced at potential miR-577 binding sites. To determine that the 3′UTR of WNT2B mRNA is directly targeted by miR-577, 2×10⁶ H522 and A549 cells were cotransfected with 0.5 µg pri-miR-577 or 20 nM ASO-miR-577 and 0.5 µg 3′UTR of WNT2B or the mutant 3′UTR of WNT2Bin in 48-well plates using Lipofectamine^® 2000 (DNA:Lipofectamine^® 2000=1:2; Invitrogen; Thermo Fisher Scientific, Inc.). The binding site of miR-577 in the WNT2B 3′UTR was mutated as follows: 5′ UAACAUUAUUAACAUUUAGAA3′. After 48 h, the EGFP activity was measured using a spectrophotometer set at 528 nm. Red fluorescent protein-expressing plasmid was integrated as a transfection efficiency control.