Directprep 96 miniprep kit

A portion of the pol/s gene was chosen for sequencing from the rcDNA and the cccDNA, respectively. The primers used, F: 5’-ACC CTG TTC TGA CTA CTG CC-3’ (nucleotides 87 to 106), and R: 5’ -ACA GCG GTA AAA AGG GAC TCA-3’ (nucleotides 800 to 780), were designed to overlap a region of both the polymerase and surface antigen genes and generated a product of 714 bp. The primers designed in the nick/gap region in cccDNA were also used as described above. Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific) was used for PCR reactions, and the initial PCR reaction was purified with QIAquick○R Gel Extraction Kit (Qiagen). Amplicons were verified for correct size and purity by DNA gel imaging prior to ligation into the pGEM-T vector (Promega). Plasmids were transformed into E. coli, and insert-containing vectors were purified (DirectPrep 96 Miniprep Kit, Qiagen) and sequenced. Sequence alignments were performed using SeqMan assembler of Lasergene 7 software package (DNAStar; Madison, WI). DMSO-treated HepAD38 or HepG2-NTCP cells were used as a untreated, negative control.

Genomic DNA was bisulfite-treated using the EZ DNA Methylation gold kit (Zymo Research) to facilitate discrimination of methylated versus nonmethylated cytosines by sequencing. The bisulfite-modified DNA was amplified by PCR with locus-specific primers (see below) and DNA was extracted using the Gel DNA Recovery Kit (Zymo Research). The PCR amplicon was cloned into a pGEM-T cloning vector (Promega) and transformed into XL10-Gold ultracompetent bacteria (Agilent Technologies). Individual bacterial colonies were grown for 20 h at 37 °C on LB agar supplemented with 100 mg l⁻¹ ampicillin, 80 mg l⁻¹ X-gal and 20 mM IPTG. White, transformed colonies were selected and subcultured into LB medium supplemented with 100 mg l⁻¹ ampicillin for 20 h at 37 °C. Cloning vectors were purified using the DirectPrep 96 MiniPrep kit (Qiagen) and the genomic insert was subsequently sequenced. Sequences were analyzed using Quantification tool for Methylation Analysis (QUMA) software and plotted in GraphPad Prism. Primer set information: Ifng: forward: GATTTAGAGTAATTTGAAATTTGTGG, reverse: CCTCCTCTAACTACTAAT ATTTATACC; Prf1: forward: GTGTGATTTATGAGATATGATGTTATATG, reverse: CCACTTCCTACTCAACCTACATCCCAC; Tcf7: forward: AGGGGAGT TGTTGTTGATTGTA, reverse: TCCACAACAACTCAACCCTAAAAA.