One step qrt pcr kit

TRIzol (Thermo, 15,596,026) were applied to extract total RNA from peripheral blood mononuclear cell (PBMC), included 4 MS patients and 5 control samples. The synthesis of total RNA into cDNA was conducted according to the instructions of the reverse transcription kit (Thermo, BTK1622). Amplification was performed by conducting real-time polymerase chain reaction in an ABI 7500 real-time PCR instrument with an one-step qRT-PCR Kit (FP303, Tiangen Biochemical Technology (Beijing) Co., Ltd.). The primers were as follows: CXCR4 forward, CTTGACACTGGATATACACTTCAG and reverse, AACAGGGTTCCTTCATGGAG; ITGAM forward, CAATATCAGGTCAGCAACCTG and reverse, ATGACAGTCTGGTTCAGCC; ACTB forward, GAAGATCAAGATCATTGCTCCTC and reverse, ATCCACATCTGCTGGAAGG; RHOA forward, AGTTCCCAGAGGTGTATGTG and reverse, CCAACTCTACCTGCTTTCCA; GAPDH forward, TCAAGATCATCAGCAATGCC and reverse, CGATACCAAAGTTGTCATGGA; GAPDH was an internal control. 2^−△△Ct was used to calculate the relative expressions. The T test was used to analyze the differences in gene expression between the two groups.

BM samples of 15 AML patients and 10 healthy controls were collected from the First Hospital of Lanzhou University (Lanzhou, China), which were approved by the Ethics Committee of the First Hospital of Lanzhou University (LDYYLL‐2023‐500).
TRIzol (TaKaRa, Japan) was used to extract total RNA. Then the qRT‐PCR reaction was conducted by CFX96 real‐time PCR System (Bio‐Rad, USA) using one‐step qRT‐PCR kit (Tiangen, China). Reaction system: 2 × SYBR Green 25 μl, 25 × Enzyme Mix 2μl, 1.25 μl of each primer for the upstream and downstream, RNA 1 μl and add ddH₂O to the total volume of 50 μl. Reaction programme: reverse transcription for 30 min at 50°C, 3 min of pre‐denaturation at 95°C, 15 s of denaturation at 95°C, annealing for 30 s at 60°C and 40 cycles total. The sequences of the primers was detailed in Table S1. The relative expression of target genes was calculated using the comparative approach (2−ΔΔCt), with GAPDH serving as the internal reference.