Qiaamp dna ffpe

Manufactured by Qiagen

Sourced in Germany

The QIAamp DNA FFPE is a DNA extraction kit designed to purify DNA from formalin-fixed, paraffin-embedded (FFPE) tissue samples. It utilizes a silica-based membrane technology to efficiently capture and elute high-quality DNA from these challenging sample types.

Automatically generated - may contain errors

Lab products found in correlation

Qiaamp dna blood mini kit, by Qiagen (2 mentions) Rneasy ffpe kit, by Qiagen (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions) Epitect bisulfite kit, by Qiagen (1 mentions) Miseq platform, by Illumina (1 mentions) Qubit fluorometer, by Thermo Fisher Scientific (1 mentions) Ion proton system, by Thermo Fisher Scientific (1 mentions) Qiaamp dna mini kit, by Qiagen (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Gentra puregene blood kit, by Qiagen (1 mentions) Qiaamp circulating nucleic acid kit, by Qiagen (1 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)

Spelling variants of this product

QIAamp DNA FFPE extraction kit (14 citations) QIAamp FFPE DNA Mini Kit (9 citations) QIAamp® DNA FFPE Advanced UNG Kit (5 citations) QIAamp® DNA FFPE Tissue Kit 50 (3 citations) QIAamp DNA FFPE Tissue Handbook (3 citations) QIAamp DNA FFPE Tissue Purification Kit (3 citations) QIAamp Gene Read DNA FFPE kit (2 citations) QIAamp DNA FFPE GeneRead Kit (2 citations) QIAamp DNA FFPE Tissue protocol (2 citations) QIAamp DNA FFPE Tissue Kit for FFPE tissue (2 citations)

11 protocols using qiaamp dna ffpe

Genomic DNA extraction from FFPE and blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the case series including paraffin embedded tissues (PETs) of “PC study”, genomic DNA was extracted from 3–5 (10 μm thick) sequential sections of PETs through QIAamp DNA FFPE (Qiagen) according to the manufacturer’s instructions and checked for adequacy by PCR amplification of the β-globin gene.
For the case series including stored blood fractions from “DD study”, DNA was obtained from 100 μl aliquots of buffy coat through QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions.
All genomic DNA samples, as well as synthetic controls for methylated and unmethylated status, underwent bisulfite modification using the Epitect Bisulfite Kit (Qiagen).

Grasso C., Trevisan M., Fiano V., Tarallo V., De Marco L., Sacerdote C., Richiardi L., Merletti F, & Gillio-Tos A. (2016). Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing. PLoS ONE, 11(3), e0150483.

+ Open protocol

+ Expand

16S rRNA Gene Sequencing of FFPE PDAC Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

16S rRNA gene sequencing methods were adapted from the methods developed for the Earth Microbiome Project (X) and NIH-Human Microbiome Project (Human Microbiome Project, 2012b (link)) (Caporaso et al., 2012 (link); Human Microbiome Project, 2012a (link), b (link)). Briefly, three sections of 10 um of FFPE of PDAC tissue were aseptically collected and placed in 1.5ml Eppendorf tube. Normal pancreatic tissue and paraffin without tissue were used as controls. Bacterial genomic DNA was extracted using Qiagen QIAamp DNA FFPE. The 16S rDNA V4 region was amplified by PCR and sequenced in the MiSeq platform (Illumina) using the 2x250 bp paired-end protocol yielding pair-end reads that overlap almost completely. The primers used for amplification contain adapters for MiSeq sequencing and single-index barcodes so that the PCR products may be pooled and sequenced directly (Caporaso et al., 2012 (link)), targeting at least 10,000 reads per sample. 16S (variable region 4 [v4]) rRNA gene pipeline data incorporated phylogenetic and alignment based approaches to maximize data resolution. The read pairs were demultiplexed based on unique molecular barcodes added via PCR during library generation, then merged using USEARCH v7.0.1090 (Edgar, 2010 (link)).

Riquelme E., Zhang Y., Zhang L., Montiel M., Zoltan M., Dong W., Quesada P., Sahin I., Chandra V., Lucas A.S., Scheet P., Xu H., Hanash S.M., Feng L., Burks J.K., Do K.A., Peterson C.B., Nejman D., Tzeng C.W., Kim M.P., Sears C.L., Ajami N., Petrosino J., Wood L.D., Maitra A., Straussman R., Katz M., White J.R., Jenq R., Wargo J, & McAllister F. (2019). Tumor Microbiome Diversity and Composition Influence Pancreatic Cancer Outcomes. Cell, 178(4), 795-806.e12.

+ Open protocol

+ Expand

Acinar Cell Carcinoma Genomic Study

Check if the same lab product or an alternative is used in the 5 most similar protocols

Acinar tumors have variants that include pure ACC, mixed acinar-ductal
adenocarcinoma, mixed acinar neuroendocrine carcinoma, and acinar cell
cystadenocarcinoma. Although including ACC variants will increase numbers in the
study, however, due to concern that genomic landscapes are different between
pure ACC and ACC variants, for the present study, we decide to concentrate on
pure acinar cell carcinoma.
All ACC cases were reviewed by an expert pancreas pathologist (L.Z.) to
ensure that only pure ACCs were included in the study. The diagnosis of ACC was
based on acinar morphologic characteristics on hematoxylin-eosin–stained
sections and positive immunohistochemical trypsin staining of acinar
differentiation, as recommended by World Health Organization criteria.²² The Mayo Clinic Institutional
Review Board approved this study.
Patients with pure ACC who underwent operation at Mayo Clinic were
participants in this study. Formalin-fixed paraffin-embedded (FFPE) slides were
macrodissected to achieve a neoplastic cellularity greater than 90%. DNA was
extracted in accordance with the protocol of the tissue kit (QIAamp DNA FFPE,
catalogue #73504; Qiagen, Hilden, Germany).

Liu Y., Raimondo M., Wallace M.B., Mody K., Stauffer J.A., Zhang L., Ji B, & Bi Y. (2021). Exome Sequencing of Pancreatic Acinar Carcinoma Identified Distinctive Mutation Patterns. Pancreas, 50(7), 1007-1013.

+ Open protocol

+ Expand

Comprehensive Cancer Gene Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Several series of sections were prepared from different parts of each specimen, and the upper and lower sections from each group were evaluated by pathologists to control for the relative cell type content. DNA was isolated from sections representative of a given component (tubular or villous adenoma) that contained the highest percentages of epithelial cells. In addition, fragments of polyps containing HGD and/or a carcinoma invading the submucosa were macrodissected. In total, DNA was extracted from 85 tumor samples using a QIAamp DNA FFPE (formalin-fixed paraffin-embedded) Tissue Kit (Qiagen), following the manufacturer's protocol.
DNA sample concentrations were measured using a Qubit fluorometer (Invitrogen), following the manufacturer's instructions, and stored at -20°C. Ion AmpliSeq Comprehensive Cancer Panel libraries were prepared from DNA for analysis of the coding regions of 409 oncogenes and tumor suppressor genes by sequencing using the Ion Proton system (Thermo).

Karczmarski J., Goryca K., Pachlewski J., Dabrowska M., Pysniak K., Paziewska A., Kulecka M., Lenarcik M., Mroz A., Mikula M, & Ostrowski J. (2019). Mutation Profiling of Premalignant Colorectal Neoplasia. Gastroenterology Research and Practice, 2019, 2542640.

+ Open protocol

+ Expand

Macrodissection and DNA Extraction from FFPE Breast Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The tumour area most suitable for macrodissection was identified by a qualified pathologist (CAM) and recorded by directly marking up the representative H&E stained section. Macrodissection of FFPE breast tumour material was performed on an average of two 3 μm unstained sections (corresponding to the marked H&E stained section). DNA was extracted using the QIAamp DNA FFPE protocol (Qiagen, Hilden, Germany) as per the manufacturer’s instructions except that the tumour material was incubated in Buffer ATL at 56 °C for 48 h, with 20 ul of Proteinase K (20 mg/ml) replenished at 0 and 24 h to increase the digestion of proteins. FFPE tumour-enriched DNA was eluted twice in Buffer ATE to achieve a final elution volume of 20 μl.

Wong E.M., Joo J.E., McLean C.A., Baglietto L., English D.R., Severi G., Hopper J.L., Milne R.L., FitzGerald L.M., Giles G.G, & Southey M.C. (2015). Tools for translational epigenetic studies involving formalin-fixed paraffin-embedded human tissue: applying the Infinium HumanMethyation450 Beadchip assay to large population-based studies. BMC Research Notes, 8, 543.

+ Open protocol

+ Expand

DNA extraction from FFPE tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from FFPE tissue using QIAamp DNA FFPE (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol. Concentration and purity (260/280 nm ratio) of DNA were determined by using the NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, USA).

Varachev V., Shekhtman A., Guskov D., Rogozhin D., Zasedatelev A, & Nasedkina T. (2024). Diagnostics of IDH1/2 Mutations in Intracranial Chondroid Tumors: Comparison of Molecular Genetic Methods and Immunohistochemistry. Diagnostics, 14(2), 200.

+ Open protocol

+ Expand

DNA Extraction from Various Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Germline, tumor, and cultured cells’ DNA were extracted with the QIAamp DNA Blood, QIAamp DNA FFPE, and QIAamp DNA Mini Kits, respectively (QIAGEN) following the manufacturer’s instructions.

Golubicki M., Bonjoch L., Acuña-Ochoa J.G., Díaz-Gay M., Muñoz J., Cuatrecasas M., Ocaña T., Iseas S., Mendez G., Cisterna D., Schubert S.A., Nielsen M., van Wezel T., Goldberg Y., Pikarsky E., Robbio J., Roca E., Castells A., Balaguer F., Antelo M, & Castellví-Bel S. (2020). Germline biallelic Mcm8 variants are associated with early-onset Lynch-like syndrome. JCI Insight, 5(18), e140698.

+ Open protocol

+ Expand

Genomic Profiling in Metastatic Oesophagogastric Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Details of the REAL3 trial have been previously described.8 (link) REAL3 eligible patients had a diagnosis of locally advanced or metastatic oesophagogastric cancer and were treated with EOX (epirubicin, oxaliplatin and capecitabine) plus or minus the fully human monoclonal IgG₂ anti-EGFR antibody panitumumab. Patients treated with EOX plus panitumumab had inferior OS compared with patients treated with EOX (HR 1.37, 95% CI 1.07 to 1.76; p=0.013). From the REAL3 patient population (n=553), pretreatment tumour biopsies (tissue blocks) with high tumour content (>30%) were selected by a pathologist. All patients included in this analysis had given informed consent for translational research. DNA was extracted from formalin fixed paraffin embedded (FFPE) pretreatment tumour biopsies using QIAamp DNA FFPE (Qiagen, Manchester, UK). Cell-free DNA (cfDNA) was extracted from two ml of patient plasma using the QIAamp DNA Blood Mini Kit (Qiagen, Manchester, UK). cfDNA was eluted in 50 µL of elution buffer and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, Loughborough, UK).

Smyth E.C., Vlachogiannis G., Hedayat S., Harbery A., Hulkki-Wilson S., Salati M., Kouvelakis K., Fernandez-Mateos J., Cresswell G.D., Fontana E., Seidlitz T., Peckitt C., Hahne J.C., Lampis A., Begum R., Watkins D., Rao S., Starling N., Waddell T., Okines A., Crosby T., Mansoor W., Wadsley J., Middleton G., Fassan M., Wotherspoon A., Braconi C., Chau I., Vivanco I., Sottoriva A., Stange D.E., Cunningham D, & Valeri N. (2020). EGFR amplification and outcome in a randomised phase III trial of chemotherapy alone or chemotherapy plus panitumumab for advanced gastro-oesophageal cancers. Gut, 70(9), 1632-1641.

+ Open protocol

+ Expand

Longitudinal Multi-Omics Analysis of IDHmut Astrocytomas

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GLASS-NL consortium has collected material from 100 IDHmut astrocytoma (1p19q non codeleted) patients who underwent at least two surgical resections. Material for analysis had to be available for both resections, and the surgical interval between resections was >6 months. Detailed clinical data, imaging, and treatment data of patients was collected within the consortium. All institutions obtained ethics approval from their institutional review boards or ethics review committees before initiation of the project. All patients provided written informed consent according to local and national guidelines.
DNA and RNA were isolated from formalin-fixed paraffin-embedded (FFPE) tumor samples as previously described (42 (link)). Evaluation of the area with highest tumor content was done by the pathologist (P. Wesseling) on a hematoxylin and eosin–stained section. Macrodissection of the marked area was then done on 10–20 10-μm consecutive slides. DNA and RNA extraction was performed using the QIAamp DNA FFPE and RNeasy FFPE kit respectively (both Qiagen). DNA methylation profiling was performed with the Infinium MethylationEPIC BeadChip according to the manufacturer's instructions making use of the Infinium FFPE DNA Restoration Kit. RNA sequencing was done by Genomescan and data processing, alignment, and further analysis of read counts was done as described previously (43 (link)).

Malta T.M., Sabedot T.S., Morosini N.S., Datta I., Garofano L., Vallentgoed W., Varn F.S., Aldape K., D'Angelo F., Bakas S., Barnholtz-Sloan J.S., Gan H.K., Hasanain M., Hau A.C., Johnson K.C., Cazacu S., deCarvalho A.C., Khasraw M., Kocakavuk E., Kouwenhoven M.C., Migliozzi S., Niclou S.P., Niers J.M., Ormond D.R., Paek S.H., Reifenberger G., Sillevis Smitt P.A., Smits M., Stead L.F., van den Bent M.J., Van Meir E.G., Walenkamp A., Weiss T., Weller M., Westerman B.A., Ylstra B., Wesseling P., Lasorella A., French P.J., Poisson L.M., Verhaak R.G., Iavarone A, & Noushmehr H. (2023). The Epigenetic Evolution of Glioma Is Determined by the IDH1 Mutation Status and Treatment Regimen. Cancer Research, 84(5), 741-756.

+ Open protocol

+ Expand

Comprehensive RNA and ctDNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted using the Gentra Puregene Blood Kit or the QIAamp DNA FFPE (Qiagen, Hilden, Germany). RNA extraction was performed using the RNeasy Mini Kit or the RNeasy FFPE Kit for FFPE material (Qiagen). RNA was converted to cDNA using PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio Europe, Saint-Germain-en-Laye, France). Quality control was performed using a 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). Due to expected low quality of the RNA extracted from FFPE, the protocol for cDNA synthesis was changed. Instead of utilizing the RT Primer Mix that is included in the kit, we used gene-specific reverse primers and the reaction samples were incubated for 60 minutes at 42 degrees Celsius instead of 15 minutes at 37 degrees Celsius. ctDNA was isolated from 1.5 ml plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen). ctDNA was eluted in 20 μl water and analyzed using a 2100 Bioanalyzer. The BCOR ITD was detected with following primers: 5’- GGCTCCTCTGTAGTCCTGGA and 5’- GGGGTGGAGCCACTCTACA.

Paret C., Russo A., Otto H., Mayer A., Zahnreich S., Wagner W., Samuel D., Scharnhorst D., Solomon D.A., Dhall G., Wong K., Bender H., Alt F., Wingerter A., Neu M.A., Beck O., Prawitt D., Eder S., Henninger N., El Malki K., Lehmann N., Backes N., Roth L., Seidmann L., Sommer C., Brockmann M.A., Staatz G., Schmidberger H, & Faber J. (2017). Personalized therapy: CNS HGNET-BCOR responsiveness to arsenic trioxide combined with radiotherapy. Oncotarget, 8(69), 114210-114225.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!