Superscript reverse transcriptase system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The SuperScript Reverse Transcriptase system is a laboratory equipment product designed for the reverse transcription of RNA into complementary DNA (cDNA). It provides a reliable and efficient tool for the conversion of RNA into cDNA, which is a crucial step in many molecular biology and genetic research applications.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Green 2 go qpcr mastermix, by Bio Basic (2 mentions) Ariamx real time pcr system, by Agilent Technologies (2 mentions) Nucleospin rna isolation kit, by Macherey-Nagel (1 mentions)

Close spelling variants of this product

Reverse transcriptase (531 citations) SuperScript reverse transcriptase (349 citations) Superscript III Reverse Transcriptase system (48 citations) SuperScript II Reverse Transcriptase system (28 citations) Reverse Transcriptase System (10 citations) SuperScript® IV Reverse Transcriptase system (5 citations) SuperScript III Reverse Transcriptase system kit (4 citations) Superscript III Reverse Transcriptase First Strand Synthesis System (4 citations) SuperScript® II RNase–Reverse Transcriptase System (3 citations) SuperScript III reverse transcriptase synthesis system (3 citations)

4 protocols using superscript reverse transcriptase system

Quantifying Gene Expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded and grown in 6-well plates until reaching 80% confluence; we incubated the cells at the time and zinc concentration indicated. Total RNA from cells was extracted using a NucleoSpin RNA isolation kit (Macherey-Nagel, Düren, Germany). RNA was measured using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). cDNA generation was conducted using a SuperScript Reverse Transcriptase system (Invitrogen, Waltham, MA, USA). Quantitative PCR was performed using SYBR Green (Applied Biosystems, Waltham, MA, USA) in the QuantStudio 12K system (Applied Biosystems, Waltham, MA, USA). Primers are listed in Table 1.
Relative mRNA abundance was calculated using the ΔΔCT method and plotted as indicated.

Vogel-González M., Musa-Afaneh D., Rivera Gil P, & Vicente R. (2021). Zinc Favors Triple-Negative Breast Cancer’s Microenvironment Modulation and Cell Plasticity. International Journal of Molecular Sciences, 22(17), 9188.

+ Open protocol

+ Expand

Quantitative RT-PCR for Viral RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. 11 µL of RNA (out of total 50 µL of RNA) was utilized for the cDNA synthesis with SuperScript Reverse Transcriptase system (Invitrogen). Two µL of 1:3 diluted synthesized cDNA was used for RT-qPCR analysis using Green-2-Go qPCR master mix (Bio Basic, New York, NY, USA) with primers Ex8_5a (TTGCTCAATGCCACAGCCAT) and Ex8_3a (TTTGACCACTTGCCACCCAT). pNL4-3 plasmid DNA was utilized as a standard. PCR amplifications were performed on an AriaMx Real-time PCR System (Agilent, Santa Clara, CA, USA) for thermal cycling and SYBR detection with two replicates for each sample. The quantification of the viral samples was determined by comparing the cycle threshold (Cq) value based on the standard curve generated by the known pnL4-3 plasmid DNA samples amount.

Sher M., Coleman B., Caputi M, & Asghar W. (2021). Development of a Point-of-Care Assay for HIV-1 Viral Load Using Higher Refractive Index Antibody-Coated Microbeads. Sensors (Basel, Switzerland), 21(5), 1819.

+ Open protocol

+ Expand

Quantification of ZnT9 Isoform Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells transfected with either ZnT9-50Met, ZnT9-50Val, or empty pCDNA3 vectors were grown in 6-well plates and incubated for 24 hours. Total RNA was extracted from cells using Macherey-Nagel total RNA extraction kit. RNA was measured using a NanoDrop 1000 spectrophotometer (Thermo Fisher). cDNA was generated using a SuperScript Reverse Transcriptase system (Invitrogen). Quantitative PCR was performed using SYBR Green (Applied Biosystems) in the QuantStudio 12K system (Applied Biosystems). Primers are listed in S20 Table.

Roca-Umbert A., Garcia-Calleja J., Vogel-González M., Fierro-Villegas A., Ill-Raga G., Herrera-Fernández V., Bosnjak A., Muntané G., Gutiérrez E., Campelo F., Vicente R, & Bosch E. (2023). Human genetic adaptation related to cellular zinc homeostasis. PLOS Genetics, 19(9), e1010950.

+ Open protocol

+ Expand

ZIKV RNA Quantification by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using Trizol Reagent (Invitrogen) according to the manufacturer’s protocol. 11 µl of RNA (out of total 50 µl of RNA) was used for cDNA synthesis with SuperScript Reverse Transcriptase system (Invitrogen, California, USA). 2 µl of (1:3 diluted) synthesized cDNA was used for RT-qPCR analysis using Green-2-Go qPCR mastermix (Bio Basic, New York, USA.) with a pair of primers specific for NR–50355 and NR-50245 genomic sequences (5′-GCAAACTGTCGTGGTTCTAG-3′, 5′-CTTTGCACCATCCATCTCAG-3′). Synthesized DNA from a conserved 429 nt region of the ZIKV genome was used as standard. PCR amplifications were performed on an AriaMx Real-time PCR System (Agilent, California, USA) for thermal cycling and SYBR detection with three technical replicates for each sample. The quantification of the ZIKV samples was determined by comparing the cycle threshold (Cq) value based on the standard curve generated by the known DNA samples amount.

Kabir M.A., Soto-Acosta R., Sharma S., Bradrick S.S., Garcia-Blanco M.A., Caputi M, & Asghar W. (2020). An antibody panel for highly specific detection and differentiation of Zika virus. Scientific Reports, 10, 11906.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!