Dual luciferase reporter assay system envision

The bioinformatics prediction website was used to predict the 3′UTR binding sequence of miR-let-7c-5p to c-myc. Dual luciferase reporter genes were used to detect the targeted binding of miR-let-7c-5p on the 3′UTR of c-myc. Briefly, the wild-type (WT) plasmid, pmirGLO-c-myc-wt and the mutant plasmid, pmirGLO-c-myc-MUT were constructed by Biosune Biotechnology (shanghai) Co.,Ltd. The WT plasmid, the mutant (MUT) plasmid and the miR-let-7c-5p mimics (UGAGGUAGUAGGUUGUAUGGUU) or NC mimics (UUCUCCGAACGUGUCACGUTT) were co-transfected into the cells by transfection reagent kit (jetPRIME; Polyplus). The activity of luciferase was determined using the Dual-Luciferase Reporter Assay System (Envision; PerkinElmer, Inc.) following 48 h of culture and Renilla luciferase was used as an internal control.

Using the bioinformatics prediction website (http://www.targetscan.org) to predict the binding fragments of Egr-1 and miR-let-7c-3p, pmirGLO-Egr-1-wt wild plasmid vector and pmirGLO-Egr-1-mut plasmid vector were constructed (Jinan Boshng Biotechnology Co., Ltd.) respectively, and cells co-transfected by transfection reagent kit (jetPRIME; Polyplus-transfection SA) with the above Egr-1 wild plasmid, Egr-1 mutant plasmid and miR-let-7c-3p mimics (sequence: CUGUACAACCUUCUAGCUUUCC) or mimics NC (sequence: UUCUCCGAACGUGUCACGUTT). The luciferase activity was measured by Dual-Luciferase Reporter Assay System (Envision; PerkinElmer, Inc.) 48 h following culture and Renilla luciferase was used as an internal control