Total RNA was isolated using the RNA extraction kit (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s protocols, and then 500 μg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the PrimeScript™ RT reagent kit (Takara, Dalian, China). For the detection of miR-377-3p expression, the Hairpin-it TM miRNAs qPCR Quantitation Kit (Genepharma, Shanghai, China) was used. The RT-qPCR assay was conducted using SYBR Green Real-Time PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) on a Thermal Cycler CFX6 System (Bio-Rad, Hercules, CA, USA) and quantified with the 2−ΔΔCt method. The expression levels of circ-CFH and RNF38 were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), while the expression level of miR-377-3p was normalized to small nuclear RNA U6. The sequences of primers are listed in Table 2 .
Hairpin ittm mirnas qpcr quantitation kit
Manufactured by GenePharma
Sourced in China
The Hairpin-itTM miRNAs qPCR Quantitation Kit is a laboratory equipment product designed for the quantitative analysis of microRNA (miRNA) expression levels using real-time PCR (qPCR) technology. The kit provides a comprehensive set of reagents and protocols to enable the sensitive and accurate quantification of miRNAs from a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Thermal cycler cfx6 system, by Bio-Rad (1 mentions)
Sybr green real time pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript preamplification system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
U6 snrna real time pcr normalization kit, by GenePharma (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
First strand cdna synthesis kit, by Takara Bio (1 mentions)
Lc480 light cycler, by Roche (1 mentions)
Trizol, by Solarbio (1 mentions)
Sybr green qpcr master mix, by Vazyme (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
9 protocols using hairpin ittm mirnas qpcr quantitation kit
1
Quantification of Circular RNA, mRNA, and miRNA
2
Comprehensive RNA Isolation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation was conducted by TRIzol Kit (Omega) following the manufacturer's instructions. The purity of isolated RNA was identified by measuring the A260/A280 ratio using a NanoDrop‐1000 apparatus (Thermo Fisher Scientific). RNA quality was analyzed by agarose gel electrophoresis of RNA. Complementary DNA (30–80 ng) was synthesized using Superscript preamplification system (Gibco BRL). Quantification of cDNA was conducted by the SYBR Premix Ex Taq II (Takara) using an AB7300 thermo‐recycler (Roche). Data were analyzed with the comparative threshold cycle (Ct) method with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) as a control. For miR‐136‐5p detection, cDNA was synthesized using Hairpin‐it TM miRNAs qPCR quantitation kit (Genepharma). The reverse product was subjected to qPCR analysis and standardized to U6. The sequence, size, and threshold cycle range of primers used in this part are shown in Table S1 .
3
Quantifying miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue samples and cell lines using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The expression levels of miRNAs were evaluated using the Hairpin-itTM miRNAs qPCR Quantitation Kit (GenePharma, Shanghai, PR China) following the manufacturer’s protocol. The U6 small nuclear RNA (RNU6B; GenePharma) was used for normalization. The relative expression ratio of miR-24 in each paired tumor and non-tumor tissue was calculated using the 2-ΔΔCT method. The miR-24 expression level was defined as upregulated when the relative expression ratio was >1, and defined as downregulated when the relative expression ratio was <1. The expression level of RegIV and c-MYC mRNA was measured by qRT-PCR according to the instructions of the SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The primers for RegIV were 5′- CACGACCCACAGAAGAGGCAGC −3′ (forward) and 5′- GGCGCTTGTTGCATTCGTTGCT −3′ (reverse). Primers for c-MYC were 5′- TCTTCCCCTACCCTCTCAACGA −3′ (forward) and 5′- TTCCTCATCTTCTTGTTCCTCCTCA −3′ (reverse). Primers for GAPDH were 5′- GGACCTGACCTGCCGTCTAG −3′ (forward) and 5′- GTAGCCCAGGATGCCCTTGA −3′ (reverse) according to the human RegIV, c-MYC and GAPDH cDNA sequences in GenBank. The GAPDH mRNA level was used for normalization. PCRs of each sample were conducted in triplicate.
4
qRT-PCR Analysis of miR-26a-5p in Rheumatic Synoviocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was carried out in all total RNA samples to evaluate miR-26a-5p expression in RA-FLS, OA-FLS, and fibroblast-like synoviocytes from knee trauma patients, using Hairpin-itTM miRNAs qPCR Quantitation kit (GenePharma, China) and Hairpin-itTM U6 snRNA qPCR Normalization kit (GenePharma, China). Small nuclear U6 RNA was quantitated as an internal control for normalization. The quantitative RT-PCR was performed by using PRISM® 7500 Sequence Detection System (ABI, U.S.A.). Quantitative RT-PCR analysis was performed according to manufacture’s instructions. All the tests were repeated three-times. Relative quantitation of miR-26a level was computed by the comparative Ct (2−ΔΔCT) method. Oligonucleotides sequences used in the qRT-PCR for miR-26a-5p were forward 5′-ACACTCCAGCTGGGTTCAAGTAATCCAGGA-3′, Reverse 5′-TGGTGTCGTGGAGTCG-3′, and for U6 were forward 5′-CTCGCTTCGGCAGCACA-3′, Reverse 5′- ACGCTTCACGAATTTGCGT-3′.
5
qRT-PCR Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s instructions. Total 600 ng RNA was subjected to reverse transcription reaction to obtain cDNAs by using the Prime Script TM RT reagent Kit (TaKaRa, Japan) as follow: 37°C for 15 min, 85°C for 5 s, and the quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) was performed on 7900HT Fast Real-Time PCR System (Applied Biosystems) using SYBR® Premix Ex Taq II (TaKaRa, Japan) as follows: 95°C for 2 min, 40 cycles of 95°C for 15 s, 60°C for 60 s. A total of 3000 ng RNA miR-451 and U6 were subjected to reverse transcription reaction to obtain cDNAs by using the Hairpin-itTM miRNAs qPCR Quantitation Kit (GenePharma, China) as follows: 25°C for 30 min, 42°C for 30 min, 85°C for 5 min. The qRT-PCR was performed using the Hairpin-itTM miRNAs qPCR Quantitation Kit as follows: 95°C for 3 min, 40 cycles of 95°C for 12 s, 62°C for 40 s. A dissociation procedure was performed to generate a melting curve for confirmation of amplification specificity. GAPDH and U6 were used as the reference gene. The relative levels of gene expression were represented as ΔCt = Ct gene – Ct reference, and the fold change of gene expression was calculated by the 2–ΔΔCt method. Experiments were repeated in triplicate. The detailed information of the primers is given in Table 1 .
6
Quantification of miRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including miRNA, was extracted from cell lines using TRIzol (Invitrogen) or the miRNeasy kit (Qiagen), according to the manufacturer’s instructions. For formalin-fixed, paraffin-embedded (FFPE) samples, total RNA was extracted from ten to fifteen 10-μm-thick sections usingmiRNeasy FFPE Kit (Qiagen). Total RNA was reverse transcribed using the PrimeScript RT reagent Kit (Takala, Dalian, China), andmiRNA sequence-specific reverse transcription (RT)-PCR for miR-7 and U6 was performed according to the Hairpin-itTMmiRNAs q-PCR quantitation kit and the U6 snRNA real-time PCR normalization kit (GenePharma). Quantitative real-time PCR was carried out using the MX3005 sequence detection system (Stratagene) with SYBR Green according to the manufacturer’s instructions. All primers are listed in Additional file 7 : Table S3. GAPDH and U6 were used as endogenous controls. All samples were normalized to the internal controls, and fold changes were calculated through relative quantification (2-△△Ct) [41 (link)].
7
Quantification of miR-370 and EGFR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted from individual types of cells using Trizol reagent (Life Technologies, Carlsbad, USA) and reversely transcribed into cDNA using the Hairpin-itTM miRNAs qPCR quantitation kit (Genepharma, Shanghai, China) or the first strand cDNA synthesis kit (Takara, Dalian, China), according to the manufacturers’ instructions. Subsequently, the relative levels of miR-370, EGFR to the control U6 and rps13 transcripts in individual samples were determined in triplicate by real-time PCR using the specific primers. The sequences of primers were forward 5′- GCCTCCAGAGGATGTTCAATAA-3′ and reverse 5′-TGAGGGCAATGAGGACATAAC-3′ for EGFR (132 bp); forward 5′-GTTGCTGTTCGAAAGCATCTTG-3′, and reverse 5′-AATATCGAGCCAAACGGTGAA-3′ for rsp13 (100 bp); forward 5′-TAGCCTGCTGG GGTGGAA-3′ and reverse 5′- TATGGTTTTGACG ACTGTGTGAT-3′ for miR-370 (73 bp); forward 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse 5′-GGAACGCTTCACGAATTTG-3′ for U6 (81 bp). The data were normalized to the rsp13 or U6 and analyzed using 2-ΔΔCt [31 (link)].
8
Quantifying RNA Transcripts via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was first extracted from the cell lines or tissues by using TRIzol (Solarbio) based on the guidebook. For mRNA or circRNA amplification, the RNA was reverse transcribed into cDNA by using a reverse transcriptase kit (ABM). Real-time PCR was performed by using the LC480 Light Cycler (Roche) with qPCR SYBR Green Master Mix (Vazyme). For circRNA amplification, divergent primer sets were applied.
For miRNA amplification, reverse transcription and real-time PCR were performed using the Hairpin-itTM miRNAs qPCR Quantitation Kit (Gene Pharma) according to the manufacturer’s instructions.
All miRNA and mRNA levels were normalized to the expression of small RNAs (sno234 and U6) or mRNA (Gapdh and β-Actin), respectively. All the primers used in this study are listed in Supplementary Table1 .
For miRNA amplification, reverse transcription and real-time PCR were performed using the Hairpin-itTM miRNAs qPCR Quantitation Kit (Gene Pharma) according to the manufacturer’s instructions.
All miRNA and mRNA levels were normalized to the expression of small RNAs (sno234 and U6) or mRNA (Gapdh and β-Actin), respectively. All the primers used in this study are listed in Supplementary Table
9
Sensitive Quantification of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA quantification, the total RNA from cell lines and tissues was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The Hairpin-it TM miRNAs qPCR Quantitation Kit (GenePharma, China) was used for miR-125b analysis. This kit contains a highly miRNA-specific RT and PCR primer set with SYBR Green dye included. The RT primer for the stem-loop-like miRNAs and the highly specific primer set for miRNAs ensure that the RT and PCR reaction proceed without interference from the miRNA precursors.
For the detection of SET expression, the following primers were used: SET forward (5′-GUC CCA CUG UCA UGU AAA UTT-3′) and reverse (5′-AUU UAC AUG ACA GUG GGA CTT-3′). miRNA and mRNA were normalized to U6 and GAPDH, respectively. All RT-PCR experiments were performed using a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The expression levels relative to U6 and GAPDH were calculated using the 2 -ΔΔCT formula.
For the detection of SET expression, the following primers were used: SET forward (5′-GUC CCA CUG UCA UGU AAA UTT-3′) and reverse (5′-AUU UAC AUG ACA GUG GGA CTT-3′). miRNA and mRNA were normalized to U6 and GAPDH, respectively. All RT-PCR experiments were performed using a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The expression levels relative to U6 and GAPDH were calculated using the 2 -ΔΔCT formula.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!