Bulge looptm mirna qpcr primer set

Total RNA was extracted using the PrimeScript^® RT reagent Kit according to the manufacturer's instructions (TaKaRa, Dalian, China). Real-time PCR was performed using a SYBR^®Premix Ex Taq™ Kit (TaKaRa, Dalian, China) and the iQ5 Real-Time PCR detection system (Bio-Rad Laboratories, California, USA). The PCR primers used for the amplification of the CREB1 mRNA are listed in Table 3. qRT–PCR was used to analyse the expression of miR-124-3p (miR-124-3p: UAAGGCACGCGGUGAAUGCC) and miR-124-5p (miR-124-5p: CGUGUUCACAGCGGACCUUGAU) and U6 snRNA using the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio, Guangzhou, China) according to the manufacturer's instructions. The expression level of CREB1 relative to that of GAPDH and the expression level of miR-124 relative to that of U6 were determined (Relative Quantity = 2^−△△CT) (Ref. 38 (link)).
Table 3.

Primers sequences used for Real-time PCR

Gene	Forward and reverse primers	Amplified fragment (bp)
GAPDH	5′ CATCAAGAAGGTGGTGAAGCA 3′	117
	5′ TCAAAGGTGGAGGAGTGGGT 3′
CREB1	5′ TGCAGACATTAACCATGACCA 3′	104
	5′ GTTGCTGGGCACTAGAATCTG 3′

Total RNAs were isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and then reverse transcribed into cDNA with iScript cDNA synthesis kit (Bio-Rad Laboratories, CA, USA). For quantitative miRNA analysis, the Bulge-Loop^TM miRNA qPCR Primer Set (RiboBio) was used to determine the expression levels of miRNAs with Takara SYBR Premix Ex Taq^TM (TliRNaseH Plus) in ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, CA, USA). U6 was used as an internal control. For mRNA analysis, cDNA was synthesized using Bio-Rad iScript^TM cDNA Synthesis Kit (Bio-Rad) and was subjected to 40 cycles of quantitative PCR with Takara SYBR Premix Ex Taq^TM (Tli RNaseH Plus, Japan) in ABI-7900 Real-Time PCR Detection System. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primer sequences (forward and reverse) used in the present study are as follows: ANP, AGCCGTTCGAGAACTTGTCTT and CAGGTTATTGCCACTTAGGTTCA; BNP, GAGGTCACTCCTATCCTCTGG and GCCATTTCCTCCGACTTTTCTC; α-SMA, GTCCCAGACATCAGGGAGTAA and TCGGATACTTCAGCGTCAGGA; Collagen I, GCTCCTCTTAGGGGCCACT and CCACGTCTCACCATTGGGG; Collagen III, CTGTAACATGGAAACTGGGGAAA and CCATAGCTGAACTGAAAACCACC; GAPDH, TGGATTTGGACGCATTGGTC and TTTGCACTGGTACGTGTTGAT. The relative expression level was calculated using the 2^-ΔΔCt method.

Total RNA was extracted from heart tissue and cardiomyocytes by using RNAiso Plus reagent (Takara, Japan) according to the manufacturer's instructions. For miRNA analysis, the expression of miRNA was determined by using stem-loop RT method with Bulge-LoopTM miRNA qPCR Primer Set (RiboBio, China) and PCR with TB green premix Ex Taq (Takara, #RR420A) in Roche480 Detection System. 5S rRNA was used as an internal control. For mRNA analysis, cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermofisher, USA) and was subjected to qPCR with Takara SYBR Premix Ex Taq. 18S rRNA was used as an internal control. The primer sequences used in this study were listed in Table S3. The relative expression level of gene or miRNA was calculated using the 2^−ΔΔCt method.

Measurement of circulating miRNAs was performed as described previously.¹³ (link) In brief, total RNA in serum was isolated by using the mirVana PARIS isolation kit (Ambion, USA). Caenorhabditis elegans miR-39 (cel-miR-39) was added as the spike-in control. The expression of miRNA was determined by using stem-loop RT method with Bulge-LoopTM miRNA qPCR Primer Set (RiboBio, China) and PCR with TB green premix Ex Taq (Takara, #RR420A) in Roche480 Detection System. The relative expression level was calculated using the 2^−ΔΔCt method.

Serum was collected by centrifugation of blood at 3000rpm for 10 min. The serum level of miR-222 was measured by relative quantification RT-PCR. RNA isolation and relative quantification RT-PCR were performed as described previously [22] (link). Briefly, exogenous cel-miR-39-3p was added as control with 50 pM final concentration in 400 μL serum, total RNA was extracted by mirVana^TM PARIS Kit (Ambion, U.S.A) and reverse transcribed into cDNA by iScript cDNA synthesis kit (Bio-Rad Laboratories, CA, U.S.A). For quantitative miRNA analysis, the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio, Guangzhou, China) and Takara SYBR Premix Ex TaqTM (TliRNaseH Plus) were used in a Real-Time PCR Detection System (Roche, Switzerland) with cel-miR-39-3p as control. 2^–ΔΔCt method was used to analyze the data.