The largest database of trusted experimental protocols

M mlv system

Manufactured by Thermo Fisher Scientific
Sourced in China

The M-MLV system is a reverse transcriptase enzyme used for the synthesis of complementary DNA (cDNA) from RNA templates. The M-MLV enzyme catalyzes the conversion of single-stranded RNA into double-stranded cDNA, which can then be used for various downstream applications, such as gene expression analysis, cloning, and sequencing.

Automatically generated - may contain errors

3 protocols using m mlv system

1

RVFV Genome Segment Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNA were extracted from the three viral stocks (AnD133719, SHM172805 and ArD141967) and were used as templates for RT-PCR. Specific primers (Table 2), the M-MLV system (Invitrogen, Carlsbad, CA, USA), and the Go-Taq PCR Kit (Promega, Madison, WI, USA) were used for cDNA synthesis and amplification, according to the manufacturer’s instructions. All primers used to amplify the S and M segments were designed according to RVFV sequences available in GenBank. Accession numbers of all RVFV sequences used to design the primers are presented in Additional file 1: Table S1. The PCR products of the expected sizes were purified directly from the agarose gel using a QIAgen Gel extraction kit and sequenced by Cogenics (Beckman Coulter Genomics, Essex, United Kingdom). Sequencing was performed in both directions, using the original reverse and forward primers as for the amplification.

List of primers used

NomSegmentPositionSequenceTm
NSngS31–48TATCATGGATTACTTTCC48
NScaS841–824CCTTAACCTCTAATCAAC50
M1FM3–22ACAAAGACCGGTGCAACTTC53.9
M1RM1120–1140CCAYGCAAAGGGTATGCAAT53.2
M2FM1035–1054TGAGGACTCTGAATTRCACCT48.7
M2RM2395–2415TCCAGAGAGTTGAGCCTTGC53.3
MRV1aM3050–3068CAAATGACTACCAGTCAGC44.6
MRV2gM2262–2292GGTGGAAGGACTCTGCGA52.5
M3FM2979–2998CAGTCCTCAGTGAGCYCATA46.1
M3RM3763–3782TCTCGGTTCTGGRGTGTGAA52.5
+ Open protocol
+ Expand
2

RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA of cells was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Concentration and purity were measured by spectrophotometer (Thermo Fisher Scientific Inc., MA, USA). Totally, 500 ng RNA was reverse transcribed into cDNA by M-MLV system (Cat no. C28025-011; Invitrogen, China). PCR reactions were performed by the 7900HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with SYBR-green (TAKARA, Japan) in a 10 μl reaction mixture. The primers are shown in additional information (Supplementary Table 2).
+ Open protocol
+ Expand
3

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed using the M‐MLV system (Cat no. C28025‐011; Invitrogen, China). qRT‐PCR quantified RNA expression using the SYBR Green Master Mix (Takara, Japan). ACTB and U6 were used as internal controls for mRNAs and miRNAs, respectively. The relative RNA abundance was calculated using the standard 2‐ΔΔCt method. The primers used in the present study are listed in Table S2. Plasmid extraction was performed according to the manufacturer’s protocols (Omega Bio‐tek, Norcross, GA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!