Log In Sign up
The largest database of trusted experimental protocols

Tissue disruptor

Manufactured by Qiagen
Visit Supplier
Sourced in Germany

The Tissue Disruptor is a lab equipment designed for the mechanical disruption of tissue samples. It uses a rotary homogenizer to efficiently break down tissues, preparing them for further processing and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Rna to cdna kit, by Thermo Fisher Scientific (2 mentions) Trizol, by Qiagen (2 mentions) Sybr green qpcr master mix 2x, by Thermo Fisher Scientific (2 mentions) Rneasy kit, by Qiagen (1 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Rneasy mini kit, by Qiagen (1 mentions)

Spelling variants of this product

Tissuelyser LT tissue disruptor (5 citations) Electronic tissue disruptor (5 citations) TissueLyser II tissue disruptor (2 citations)

4 protocols using tissue disruptor

1

Cytokine Expression Analysis in Mouse Hearts

Check if the same lab product or an alternative is used in the 5 most similar protocols
For measuring cytokine expression in tissue, hearts were collected from mice and immediately frozen in dry ice for later processing. For Tissue was homogenized in Trizol (Qiagen) by mechanical disruption by using the Tissue Disruptor (Qiagen) and the RNA was then extracted following the manufacturer’s instructions. 0.1–1 μg total RNA was reverse-transcribed for 1 hour at 37 °C using RNA-to-cDNA kit (Applied Biosystems). qPCR was performed using the SYBR green qPCR master mix 2x (Fermentas, Thermo Scientific) and the following primers:
Agudo J., Ruzo A., Park E.S., Sweeney R., Kana V., Wu M., Zhao Y., Egli D., Merad M, & Brown B.D. (2015). JEDI T-cells enable targeted cell depletion and investigation of T-cell interactions with virtually any cell population. Nature biotechnology, 33(12), 1287-1292.
+ Open protocol
+ Expand
2

Cytokine Expression Analysis in Mouse Hearts

Check if the same lab product or an alternative is used in the 5 most similar protocols
For measuring cytokine expression in tissue, hearts were collected from mice and immediately frozen in dry ice for later processing. For Tissue was homogenized in Trizol (Qiagen) by mechanical disruption by using the Tissue Disruptor (Qiagen) and the RNA was then extracted following the manufacturer’s instructions. 0.1–1 μg total RNA was reverse-transcribed for 1 hour at 37 °C using RNA-to-cDNA kit (Applied Biosystems). qPCR was performed using the SYBR green qPCR master mix 2x (Fermentas, Thermo Scientific) and the following primers:
Agudo J., Ruzo A., Park E.S., Sweeney R., Kana V., Wu M., Zhao Y., Egli D., Merad M, & Brown B.D. (2015). JEDI T-cells enable targeted cell depletion and investigation of T-cell interactions with virtually any cell population. Nature biotechnology, 33(12), 1287-1292.
+ Open protocol
+ Expand
3

Corneal Gene Expression After CXL

Check if the same lab product or an alternative is used in the 5 most similar protocols
One week after CXL treatment the rabbits were sacrificed (intravenous 120 mg/kg, Pentothal; Ospedalia AG, Hünenberg, Switzerland) and the corneas obtained with a trephine (8 mm diameter). The corneal tissue was immersed in RLT lysis buffer + 1% β-mercaptoethanol and homogenized, first with scissors and then with a tissue disruptor (Qiagen GmbH, Hilden, Germany). Afterwards, samples were frozen in liquid nitrogen and stored at −80°C.
Then, mRNA of the entire cornea, including epithelial, keratocyte, and endothelial cells, was extracted using an RNeasy kit (Qiagen) according to the manufacturer's instructions. mRNA quantity and quality were assessed with a spectrophotometer (Qbit; Life Technologies, Carlsbad, CA, USA) and the Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), respectively.
Kling S., Hammer A., Netto E.A, & Hafezi F. (2017). Differential Gene Transcription of Extracellular Matrix Components in Response to In Vivo Corneal Crosslinking (CXL) in Rabbit Corneas. Translational Vision Science & Technology, 6(6), 8.
+ Open protocol
+ Expand
4

Transcriptomic Analysis of C. elegans lpd-3 Mutant

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
N2 wild type and lpd-3(ok2138) animals were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using TissueDisruptor and the RNeasy Mini Kit from Qiagen. RNA preparations were used for qRT-PCR or RNAseq. For qRT-PCR, reverse transcription was performed by SuperScript III, and quantitative PCR was performed using LightCycler Real-Time PCR Instruments. Relative mRNA levels were calculated by ∆∆CT method and normalized to actin. Primers for qRT-PCR: act-3 (forward, tccatcatgaagtgcgacat; reverse, tagatcctccgatccagacg) and fat-7 (forward, tgcgttttacgtagctggaa; reverse, caccaacggctacaactgtg). RNAseq library preparation and data analysis were performed as previously described28 . Three biological replicates were included for each treatment. The cleaned RNAseq reads were mapped to the genome sequence of C. elegans using hisat266 (link). Abundance of genes was expressed as FPKM (Reads per kilobase per million mapped reads). Identification of differentially expressed genes was performed using the DESeq2 package67 (link).
Wang C., Wang B., Pandey T., Long Y., Zhang J., Oh F., Sima J., Guo R., Liu Y., Zhang C., Mukherjee S., Bassik M., Lin W., Deng H., Vale G., McDonald J.G., Shen K, & Ma D.K. (2022). A conserved megaprotein-based molecular bridge critical for lipid trafficking and cold resilience. Nature Communications, 13, 6805.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!