Abi prism 7900 sequence detection system of sybr green 2

The TRIzol (Invitrogen) was used to extract the total RNA from cells or tumor tissues. The PrimeScript RT reagent kit (Takara Biotechnology, Inc., Kyoto, Japan) was used for reverse transcription of RNA into cDNA. The TaqMan primers and probes were all from Takara. The qPCR was performed according to the ABI PRISM 7900 sequence detection system of SYBR Green II (Takara Biotechnology, Inc.). The reaction conditions were pre-denaturation at 95°C for 5 min and 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 20 s, and extending at 72°C for 35 s. GAPDH is the internal reference for ANXA2 and U6 is the internal reference for miR-206 and the 2^-ΔΔCt method was used to analyze gene expression. The primer sequences (synthetized by Sangon Biotech Co., Ltd., Shanghai, China) are shown in Table 1.

The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA content. The PrimeScript RT reagent kit (Takara, Dalian, China) was used for reverse transcription of the RNA content into cDNA. The qPCR was performed in strict compliance with the ABI PRISM 7900 sequence detection system of SYBR Green II (Takara Biotechnology). The reaction conditions were as follows: pre-denaturation at 95°C for 5 min and 40 cycles of denaturation at 95°C for 15s, annealing at 60°C for 20 s and extension at 72°C for 35s. GAPDH and U6 were regarded as internal parameters while the analysis was conducted based on the 2^−ΔΔCt method. The primer sequences synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) are shown in Table 1.Table 1.

Primer sequence

Gene	Forward 5ʹ-3’	Reverse 5ʹ-3’
miR-135b-5p	AGGGCACAGGAGGGGC	AGTGCAGGGTCCGAGGTATT
FOXO1	CGTAAGCTGGGAGAGACCTG	GGATGGATGGGAATGAACAC
GAPDH	CTCAGACACCATGGGGAAGGTGA	ATGATCTTGAGGCTGTTGTCATA
U6	ATTGGAACGATACAGAGAAGATT	GGAACGCTTCACGAATTTC