Human studies were approved by the Ethics Committee of the Hospital Clínico San Carlos, and all subjects gave informed consent. Liver biopsies were obtained from morbidly obese patients undergoing bariatric surgery or control patients undergoing surgery for gastroesophageal reflux disease (4 patients), achalasia (1 patient), and cholelithiasis (2 patients), during the years 2004–2009 at the Hospital Clínico San Carlos. The bariatric surgery patients and controls were post-hoc age and sex matched. Clinical and biochemical data taken at the time of surgery were obtained from the chart. Clinical and biochemical data were available for all patients undergoing bariatric surgery. For the controls, glucose and total cholesterol levels were available in 6 patients, triglycerides in 5 patients, and HDL and LDL in three patients. For gene expression, RNA was isolated (TRI Reagent, Sigma-Aldrich), cDNA was synthesized (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems), and FMO3 gene expression was measured (TaqMan human FMO3 Gene Expression Assay Hs00199368_m1 and human 18s rRNA as reference gene, Applied Biosystems). Expression was calculated via the ΔΔCt method.
Human 18s rrna
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Human 18S rRNA is a component of the small subunit (40S) of the eukaryotic ribosome. It is a highly conserved RNA sequence that plays a crucial role in the translation of genetic information into proteins.
Automatically generated - may contain errors
Lab products found in correlation
Taqman human fmo3 gene expression assay hs00199368 m1, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Tri reagent, by Merck Group (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Human chop, by Thermo Fisher Scientific (2 mentions)
Human gadd34, by Thermo Fisher Scientific (2 mentions)
Mouse chop, by Thermo Fisher Scientific (2 mentions)
Mouse gadd34, by Thermo Fisher Scientific (2 mentions)
Mouse β actin, by Thermo Fisher Scientific (2 mentions)
Rat β actin, by Thermo Fisher Scientific (2 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Abi viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Verso 1 step rt qpcr kit, by Thermo Fisher Scientific (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
7 protocols using human 18s rrna
1
Hepatic FMO3 Expression in Obese Patients
2
Obesity-related Liver Transcriptomic Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human studies were approved by the Ethics Committee of the Hospital Clínico San Carlos, and all subjects gave informed consent. Liver biopsies were obtained from morbidly obese patients undergoing bariatric surgery or control patients undergoing surgery for gastroesophageal reflux disease (four patients), achalasia (one patient) and cholelithiasis (two patients), during the years 2004–2009 at the Hospital Clínico San Carlos. The bariatric surgery patients and controls were post-hoc age and sex matched. Clinical and biochemical data taken at the time of surgery were obtained from the chart. Clinical and biochemical data were available for all patients undergoing bariatric surgery. For the controls, glucose and total cholesterol levels were available in six patients, triglycerides in five patients, and HDL and LDL in three patients. For gene expression, RNA was isolated (TRI Reagent, Sigma-Aldrich), cDNA was synthesized (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems), and FMO3 gene expression was measured (TaqMan human FMO3 Gene Expression Assay Hs00199368_m1 and human 18 s rRNA as reference gene, Applied Biosystems). Expression was calculated via the ΔΔCt method.
3
Quantification of Intracellular and Extracellular HCV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subsequent to various miRNA or siRNA treatments, Huh7.5.1 cells were infected with HCV JFH1 strain for 48 h. Total cellular RNA was then extracted using the RNeasy Mini Kit (Qiagen), and viral RNA from supernatants was isolated using QIAamp Viral RNA Mini Kit (Qiagen). Quantitative RT-PCR (qPCR) was performed to measure intracellular and extracellular HCV RNA copy numbers, using Verso 1-Step RT-qPCR Mix (Life Technologies) on an ABI ViiA 7 Real-Time PCR System (Applied Biosystems). PCR parameters were described previously8 (link). HCV primer sequences were: (forward) CGGGAGAGCCATAGTGG, and (reverse) AGTACCACAAGGCCTTT CG (IDT). HCV TaqMan probe used was: 6-FAM CTGCGGAACCGGTGAGTACAC TAMRA (IDT). Human 18S rRNA (Applied Biosystems) was used as the internal control.
4
Quantification of Intracellular and Extracellular HCV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intracellular RNA was extracted from whole-cell lysates using the RNeasy Mini Kit (Qiagen). Viral RNA from supernatants (extracellular HCV RNA) was isolated using a QIAamp Viral RNA Mini Kit (Qiagen). Copy numbers of intracellular and extracellular HCV RNA were determined by Q-PCR using Verso 1-Step RT-qPCR Kit (Thermo Fisher Scientific) with previously described probe, primers, and parameters (Li et al. 2009 (link)). The relative amount of HCV RNA was normalized to the housekeeping control gene human 18S rRNA (Thermo Fisher Scientific). Q-PCR was performed on a ViiA 7 Real-Time PCR System (Applied Biosystems).
5
Quantitative RT-PCR of ER Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
300 ng of total RNA was reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Scientific). The resulting cDNA was then used for real-time PCR (15 ng per reaction) with the following TaqMan assays: human CHOP, human GADD34, human 18S rRNA, mouse CHOP, mouse GADD34, mouse β-actin, rat β-actin, and GFP (all Thermo Scientific). The resulting Ct values were analyzed using the 2ΔΔCt method and expressed as fold change.
6
Multiplex RT-PCR Assay for Arboviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification assays by real time RT-PCR were performed with QuantiTect/QuantiNova Probe RT-PCR Kit (Qiagen®) according to manufacturer’s conditions in 25 μL of reaction volume, including 5 μL RNA, 1μM each primers Forward/Reverse (F/R) and 0.2 μM probe shown in Table S1 . Reverse transcription was carried out at 50 °C for 30 min, initial denaturation at 95 °C for 15 min, followed by 50 cycles of denaturation at 94 °C for 15 s, and annealing at 55 °C for 35 s. Samples with cycle threshold (ct) values lower than 40 and with sigmoid curves were considered positive.
Of note, the four serotypes of DENV, CHIKV and ZIKV were tested in the plasma or serum samples. The urine sample was tested for ZIKV RNA. For quality assurance purposes, different controls were included: mock-controls from extraction, non-template controls of RT-PCR reaction, positive controls for each virus and human 18 S rRNA (ThermoFischer, Waltham, Masschusetts, USA) for each sample.
Of note, the four serotypes of DENV, CHIKV and ZIKV were tested in the plasma or serum samples. The urine sample was tested for ZIKV RNA. For quality assurance purposes, different controls were included: mock-controls from extraction, non-template controls of RT-PCR reaction, positive controls for each virus and human 18 S rRNA (ThermoFischer, Waltham, Masschusetts, USA) for each sample.
7
Quantifying ER Stress Response Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
300 ng of total RNA was reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Scientific). The resulting cDNA was then used for real-time PCR (15 ng per reaction) with the following TaqMan assays: human CHOP, human GADD34, human 18S rRNA, mouse CHOP, mouse GADD34, mouse β-actin, rat β-actin, and GFP (all Thermo Scientific). The resulting Ct values were analyzed using the 2ΔΔCt method and expressed as fold change.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!