Realplex mastercycler ep gradient s

Total RNA was extracted from microglial cells using QIAzol Lysis Reagent (#79306) purchased from Qiagen (Hilden, Germany). RNA concentration and quality were checked by using the Nanodrop ND-1000 machine (Peqlab, Erlangen, Germany). Complementary DNA (cDNA) was synthesized using RevertAid First Strand cDNA Synthesis kit (#K1612) from Thermo Fisher Scientific (Waltham, MA, USA). qPCR reaction was performed by using Realplex Mastercycler EpGradient S (Eppendorf AG, Germany). The following primer pairs were used: HIF-1α forward: CTCATCAGTTGCCACTTCC and HIF-1α reverse: TCATCTTCACTGTCTAGACCAC, MyD88 forward: TCCGGCAACTAGAACAGACAGACT and MyD88 reverse: GCGGCGACACCTTTTCTCAAT, TLR4 forward: ACCTGGCTGGTTTACACGTC and TLR4 reverse: CAGGCTGTTTGTTCCCAAAT, GAPDH forward: CATGGCCTTCCGTGTTTCCTA and GAPDH reverse: CCTGCTTCACCACCTTCTTGAT. GAPDH was used as housekeeping gene. Relative gene expression was calculated using the comparative C_T ( $2_{\text{T}}^{-\Delta \Delta \text{C}}$ ) method (24 (link)).

The 19 shoot samples were used for qPCR to verify RNA-Seq gene expression calls using primers for four target genes and primers for 18S [74 (link)] as an endogenous control. cDNA and a reverse transcription (RT) control were produced using a QuantiTect Reverse Transcription Kit (QIAGEN), incorporating a DNA removal step. qPCR reactions, no template controls and RT controls, were conducted in triplicate using 10 μl PrecisionPlus SYBRgreen Mastermix (Primerdesign, UK), 200 nM per primer and 1 μl cDNA or deionized water in a 20 μl reaction. Reactions were conducted using a realplex Mastercycler epgradient S (Eppendorf, Germany), and standard curve data was used to calculate reaction efficiencies for all primer pairs. Melt curves were employed to check for non-specific amplification and contamination. Expression was normalized to 18S, and statistical analyses were conducted using GLMs and post hoc Tukey tests in Minitab. Where there was non-normality, log₂-transformed data was used. Pair-wise fold changes and standard errors plus log₂FCs were calculated from the mean normalized expression levels for each treatment, and regressions of RNA-Seq log₂FC against qRT-PCR log₂FC were conducted in SigmaPlot 2001.

The miRNAs were isolated from serum samples as previously described [17 (link)], and reverse transcribed to cDNA using the TaqMan Advanced miRNA cDNA Synthesis Kit (Applied Biosystems; Life Technologies) according to the manufacturer’s instructions. The qRT-PCR reactions were carried out using TaqMan Fast Advanced Master Mix (Applied Biosystems; Life Technologies) by using Realplex Mastercycler epgradient S (Eppendorf). The exogenous control (Cel miR-39) was used for normalization and the results were expressed as 2^−ΔCt.

RNA isolated from the samples were converted to cDNA by using high-capacity RNA to cDNA kit (Thermo Fisher Scientific, Ireland). Primers based on the selected genes of interest were designed with 6-FAM/ZEN/IBFQ double-quenched probes and synthesized commercially by Integrated DNA Technologies (IDT, Belgium) (Supplementary Table 2). The cDNA was used as a template and analysis was done by the addition of PrimeTime Gene Expression Master Mix. qRT-PCR was performed in an Eppendorf Mastercycler realplex ep gradient S (Eppendorf, United Kingdom). This analysis was carried out in two biological replicates each along with three technical replicates. The fold-change in the expression of the genes of interest was determined by the method of Livak and Schmittgen (2001) (link), i.e., 2^–ΔΔCt method using rho as a housekeeping gene.

Total RNA was extracted from adherent cells using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. Real-time PCR was performed using a Mastercycler Realplex ep gradient S (Eppendorf). Primer sequences: COL1A1 forward 5′ ATGTAGGCCACGCTGTTCTT 3′ and COL1A1 reverse 5′ GAGAGCATGACCGATGGATT 3′. PCR amplification was carried out for 40 cycles at a melting temperature of 95 °C for 15 s and an annealing temperature of 60 °C for 1 min. A dissociation curve was analyzed for each PCR experiment to assess primer–dimer formation or contamination. Relative mRNA level quantifications of target genes were determined using the cycle threshold method with ATP5B and β2 microglobulin (β2M) as housekeeping genes (PrimerDesign Ltd. Primer sequences for housekeeping genes are proprietary, accession numbers supplied by manufacturer: NM_001686 (ATP5B), NM_004048 (β2M)), and the data were expressed as the expression relative to the housekeeping genes.

The reverse transcriptase reaction was carried out on RNA purified earlier from K. pneumoniae MGH78578 under the same conditions mentioned earlier. A high-capacity RNA-to-cDNA preparation kit (Sigma) was used by following the manufacturer’s guidelines. A negative control devoid of RT enzyme was also included. qPCR was then performed by following the prime-time gene expression master mix protocol (IDT, Leuven, Belgium) in an Eppendorf Mastercycler RealPlex ep gradient S (Eppendorf, Arlington, United Kingdom) according to the manufacturer’s instructions. Samples were run for 3 biological replicates, each of which had three technical replicates. Data were analyzed using RealPlex software. The relative fold increases in expression levels (changes in threshold cycle [ΔC_T]) were normalized based on the gene expression levels of the housekeeping gene rpoB relative to the soxS gene. Comparative quantification was carried out using the ΔΔC_T approach. The sequences of all primers used in the experiment are provided in Table S1, WS1.