Gv118

Interfering RNAs were delivered by transfection of T24 and 5637 cells with lentivirus vector (GV118, Genechem, Shanghai, China) packaging plasmids containing short hairpin RNAs (shRNAs).To decrease the levels of endogenous NRP1 or NUPR1, NRP1 specific shRNAs (shNRP1) or NUPR1 specific shRNAs (shNUPR1) were cloned into GV118 lentivirus vector, and shNRP1 lentivirus 3.30μl (3E+8 TU/ml), or shNUPR1 lentivirus 3.30μl (7E+8 TU/ml), or negative control shRNAs lentivirus 1.00μl (1E+9 TU/ml) were added into each well (5×10⁴ cells per well in 6-well plates) in the presence of 5μg/mL polybrene. Forty-eight hours after infection, cells expressing shRNA were selected using 0.5mg/mL puromycin for 10 days. qRT-PCR was used to test the expression of NRP1 or NUPR1 in infected cells. The target sequence of shNRP1-1 was 5′-GCCTTGAATGCACTTATAT-3′, that of shNRP1-2 was 5′-GACCCATACCAGAGAATTA-3′, and that of shNRP1-3 was 5′-AACGATAAATGTGGCGATA-3′. The sequence of the control shRNAs was 5′-TTCTCCGAACGTGTCACGT-3′. The sequence of shNUPR1-1 was 5′-CCAAGCTGCAGAATTCAGA-3′.

Primary mouse neuronal cultures were obtained from the cerebral cortex of embryos [embryonic day 17 (E17) to E18; Hozumi et al., 2003 (link)). For neuron transfection, lentiviral vectors were used with 1 × 10⁸ transduction units/ml (multiplicity of infection, 10). To suppress and overexpress FMR1, we used GV118 (Shanghai Genechem) with the target sequence 5′-ACGAAACTTAGTAGGCAAA-3′ and the GV303 vector (Shanghai Genechem) with full-length FMR1, respectively. After 24 h of transfection, the neurons were cultured for 2 d for protein measurement, and for 8 d for morphological observation of the dendritic spines. Dil staining was performed as described previously (Cheng et al., 2014 (link)), and dendritic spines were examined using an FV1000 confocal microscope (FluoView1000, Olympus). Spine head width and length of dendritic protrusions were measured by ImageJ. Only spines within 100 μm cell bodies were evaluated.

To construct a shRNA vector to knockdown CLSTN1, we used a lentiviral vector GV118 (Shanghai Genechem Co, Ltd.) and determined that the best target sequence is 5′-TAGTGAAGATAAGCGTCAA-3′ (Figure S1 and Table S1). The scrambled control sequence for shRNA (5′-TTCTCCGAACGTGTCACGT-3′) (control shRNA) was also expressed from the GV118 vector and did not target any known mouse cDNA sequence. The full length of CLSTN1 was amplified using a forward primer (5′-AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCGCCGCCCTGCGCCCGCGCTG-3′) and a reverse primer (5- TCCTTGTAGTCCATACCGTAGCTGAGTGTGGAGTCATCCCATTCCAGCTGTC-3′). Amplified CLSTN1 cDNA was ligated into the GV492 vector (Shanghai Genechem Co., Ltd.) to obtain the EGFP-CLSTN1-lentiviral vector. The full length of ICAM5 was amplified using a forward primer (5′-GAGGATCCCCGGGTACCGGTCGCCACCATGCCGGGGCCTTCGCCAGGGCTGC-3′) and a reverse primer (5′-CACACATTCCACAGGCTAGTCAGGAAGATGTCAGCTGGATAGC-3′). Amplified ICAM5 cDNA was ligated into the GV326 vector (Shanghai Genechem Co., Ltd.) to obtain the Cherry-ICAM5-lentiviral vector.