Genomic DNA was extracted using the Genomic DNA Kit (Geneaid Biotech Ltd., Taoyuan, Taiwan) and quantified with SpectraMax® i3x (Molecular Devices, San Jose, CA, USA). The relative DNA copy number (mitochondrial DNA to nuclear DNA) of three mitochondrial genes, ND2, ND4L, and nuclear GAPDH, was measured by quantitative real-time PCR (qPCR). The primer sets are listed as follows: ND2 forward: CATATACCAAATCTCTCCCTC, ND2 reverse: GTGCGAGATAGTAGTAGGGTC; ND4L forward: TAGTATATCGCTCACACCTC, ND4L reverse: GTAGTCTAGGCCATATGTG; GAPDH forward: GAAGGTGAAGGTCGGAGTC, GAPDH reverse: GAAGATGGTGATGGGATTTC. The mitochondrial copy number (mtCN) was quantified using the delta CT (ΔCT) of mtDNA and nuclear DNA (ΔCt = CT [mtDNA] − CT [GAPDH]). The fold change was calculated by 2−ΔΔCT. ΔΔCT was determined by ΔCT [FT895 treated] − ΔCT [DMSO control].
Genomic dna kit
Manufactured by Geneaid
The Genomic DNA Kit is a laboratory equipment designed for the extraction and purification of high-quality genomic DNA from a variety of sample types. It utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing a reliable and consistent method for DNA isolation.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using genomic dna kit
1
Quantifying Mitochondrial DNA Copy Number
2
Bisulfite-based DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of the OCSPCs and tumors was isolated with a Genomic DNA kit (Geneaid Biotech, Bade City, Taiwan). The DNA was converted with sodium bisulfite using a CpGenome DNA modification kit (Millipore, MA, USA), purified and amplified by PCR with ThermoHotStart 2X Gold PCR Master mix (Applied Biosystems) with primers (Additional file 2 : Table S2) at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 40 s, with a final extension at 72 °C for 10 min and holding at 4 °C. Bisulfite-modified, Sss I-treated normal lymphocyte DNA served as the positive methylated control, and bisulfite-treated normal lymphocyte DNA served as the unmethylated control.
3
Methylation Analysis of HIN-1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of the tumor cells was isolated using a Genomic DNA kit (Geneaid Biotech, Bade City, Taiwan), converted with sodium bisulfite using a CpGenome DNA modification kit (Millipore, MA, USA), purified, and then amplified by a PCR with DNA polymerase (ThermoHotStart 2× Gold PCR Master mix; Applied Biosystems) and HIN-1-specific primers. The primer sequences for methylated HIN-1 were 5’-GAAGTTTCGTGGTTTTGTTCG-3’ (forward) and 5’-AAAACCTAAAATCCACGATCGAC-3’ (reverse), and the primer sets for unmethylated HIN-1 were 5’-TAAGAAGTTTTGTGGTTTTGTTTGG-3’ (forward) and 5’-AAAAAACCTAAAATCCACAATCAAC-3’ (reverse). Bisulfite-modified Sss I (New England Biolabs, MA)-treated normal lymphocyte DNA served as the methylated control, and bisulfite-treated normal lymphocyte DNA as the unmethylated control. PCR products were analyzed on 3 % agarose gels. A methylation specific-PCR in a final volume of 20 μl was performed under the following conditions: 95 °C for 10 min, followed by 40 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 40 s, with a final extension at 72 °C for 10 min and holding at 4 °C. The PCR products were purified and then directly sequenced using an Applied Biosystems ABI automated DNA sequencer.
4
Citrus Plant DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA extraction of the citrus plants was conducted following the Genomic DNA Kit (Geneaid) protocol. A young leaf sample was weighed at 50–100 mg and added with 400 µl of GP1 buffer. It was then vortexed and incubated in a water bath at 60 °C for 30 min. The mix was turned upside down every 10 min. As much as 100 µl of GP2 buffer was added, followed by vortexing, incubation in ice for 10 min, and centrifugation at 10,000 g for 5 min. A filter column was set in a 2 ml tube. The supernatant was pipetted and transferred to the filter column and then centrifuged at 1,000 g for 1 min. The column was then discarded. The supernatant was added with 700 µl of GP3 buffer and quickly turned upside down. A GD column was set in a 2 ml tube, and all solution was pipetted into it before being centrifuged for 2 min. To the GD column 400 µl of W1 buffer was added, followed by centrifugation at 10,000 g for 1 min. The supernatant was then removed. The GD column was centrifuged for 3 min and then transferred to a 1.5 ml tube, added with 100 µl of pre-heated elution buffer/TE precisely at the center of the column for 5 min, and centrifuged at 10,000 g for 1 min. The GD column was then discarded. The solution derived was a DNA solution, which was later added with 3 µl of RNAse.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!