The hindlimbs from e12.5 wild type and ΔLARM1/2 homozygous embryos were dissected out in cold RNase-free 1X phosphate-buffered saline (PBS) pH 7.4. Total RNA was extracted with RNeasy Plus Mini Kit (Qiagen) and 500 ng of total RNA was reverse transcribed to produce first-strand cDNA with iScriptTM cDNA Synthesis kit (Bio-Rad) using standard conditions. RT-qPCR was carried out on an Applied Biosystems StepOnePlus using NZYSpeedy qPCR Green Master Mix, ROX plus (NZYTech). The primers used to amplify Lmx1b were forward (Fwd), GAGCAAAGATGAAGAAGCTGGC37 (link), and reverse (Rev), GGCCACGATCTGCTGCTG. Relative transcript levels were normalized to GAPDH (Fwd, TGCAGTGGCAAAGTGGAGAT; Rev, ACTGTGCCGTTGAATTTGCC). Three-four biological replicates were analyzed for each genotype, with 3 technical replicates per sample. The expression levels of mutant samples were calculated relative to wild-type controls (average set to 1). Significance of differences were determined using the two-tailed, unpaired t-test and reported with standard deviation error bars.
Rox plus
Manufactured by NZYTech
Sourced in Portugal
The ROX plus is a versatile laboratory equipment designed for various applications. It features precise temperature control and consistent heat distribution for efficient sample processing. The device's core function is to provide a reliable and consistent heating solution for researchers and scientists.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nzyspeedy qpcr green master mix, by NZYTech (2 mentions)
One step nzyspeedy rt qpcr green kit, by NZYTech (2 mentions)
Dnase 1, by Merck Group (2 mentions)
Steponeplus, by NZYTech (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
High pure rna isolation kit, by Roche (1 mentions)
Nzyspeedy qpcr green master mix 2, by NZYTech (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nzy total rna isolation kit, by NZYTech (1 mentions)
5 protocols using rox plus
1
Quantifying Lmx1b Expression in Mutant Limbs
2
Quantifying Pepino Mosaic Virus in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the DNase I treatment (Sigma‐Aldrich) of total RNA samples, the virus accumulation was measured by RT‐qPCR using One‐step NZYSpeedy RT‐qPCR Green Kit and ROX Plus (NZYTech) with specific primers for PepMV‐EU (CE‐2651 5′‐CCCCAAGTGGACTGCGTTAC‐3′ and CE‐2652 5′‐GCAGCATTGTCGTCATCAGT‐3′) and PepMV‐CH2 (CE‐2816 5′‐AACCCAAGGCTGCTGATAACA‐3′ and CE‐2817 5′‐AAGCCGTGTGCATTAAGCAA‐3′). Pure viral RNA was obtained from the virion preparations with a phenol‐chloroform extraction, following the protocol described by AbouHaidar et al. (1998 ). The standard curve for absolute quantification was then prepared performing 1:10 serial dilutions of this pure viral RNA.
3
Quantitative Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from frozen cell pellets was extracted using the High Pure RNA Isolation Kit (Roche, Switzerland). Following quantification in a NanoVue™ Plus spectrophotometer (GE Healthcare, USA), 1 μg of RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcriptase Kit (Life Technologies). Reactions were run in triplicate using NZYSpeedy qPCR Green Master Mix, ROX plus (NZYTech, Portugal), and primers specific for OCT4, NANOG, SOX1, T/BRACHYURY and SOX17 in a StepOne Plus Real-Time PCR System (Thermo Fisher Scientific). CT values for each condition were normalised against the corresponding expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), generating ΔCT. RNA levels were computed as 2–ΔCT.
4
Osteogenic Differentiation of Dental and Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 21 days of osteogenic differentiation, PDLSC, MSC(M) and MSC(AT) total RNA was extracted using RNeasy Mini Kit (QIAGEN, Hilden, Germany), followed by cDNA synthesis with High-Capacity cDNA Reverse Transcription kit (Life Technologies, Carlsbad, CA, USA). Primer sequences used are summarized in Table 1 , and qRT-PCR was performed using NZYSpeedy qPCR Green Master Mix (2×), ROX plus (NZYTech, Lisbon, Portugal) and StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). Reactions were performed in triplicate and carried out for 10 min at 95 °C, followed by 40 cycles of 15 sec at 95 °C and 1 min at 60 °C. Gene expression was normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and fold-change was calculated considering baseline expression at day 0 (undifferentiated cells). A threshold cycle (Ct) was observed in the exponential phase. ΔΔCt values were calculated using geometric means and expressed as 2−ΔΔCt.
5
Quantification of PepMV Viral Accumulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plant samples were ground in liquid nitrogen, and RNA was extracted using the NZY Total RNA Isolation kit (NZYTech, Portugal) following the manufacturer’s instructions. Extracts were treated with DNaseI (Sigma-Aldrich), and viral accumulation was quantified by RT-qPCR using the One-step NZYSpeedy RT-qPCR Green Kit and ROX Plus (NZYTech, Portugal) with specific primers for PepMV-EU and PepMV-CH2 (Gómez et al., 2009 (link)). To prepare viral RNA as pure as possible, virion purification was performed as in Agirrezabala et al. (2015) (link), and RNA extraction from virions was performed following the protocol described by AbouHaidar et al. (1998) (link). Then, 10-fold serial dilutions of the viral RNA from disassembled PepMV-EU or PepMV-CH2 virions were used to prepare the standard curves used for viral quantification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!