Bst 2.0 WarmStart DNA polymerase, MgSO4 (100 mM) and 10 × Thermopol Isothermal buffer containing 200 mM Tris-HCl, 500 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4 and 1 % Tween-20 were purchased from New England BioLab (NEB, USA). A 10 mM deoxynucleotide (dNTP) solution was purchased from Vazyme Biotech (China). Eva Green dye was purchased from Biotium Inc. (USA). SYBR Green dye was purchased from Solarbio Science & Technology (China). Tween-20, Triton X-100, dithiothreitol and guanidine hydrochloride were purchased from Sangon Biotech (China).
Sybr green dye
Manufactured by Solarbio
Sourced in China
SYBR Green dye is a fluorescent dye used in molecular biology applications, particularly for real-time PCR and DNA gel electrophoresis. It binds to double-stranded DNA, resulting in increased fluorescence upon excitation, allowing for the detection and quantification of DNA.
Automatically generated - may contain errors
Lab products found in correlation
Evagreen dye, by Biotium (1 mentions)
Bst 2.0 warmstart dna polymerase, by New England Biolabs (1 mentions)
Triton x 100, by Sangon (1 mentions)
Dithiothreitol (dtt), by Sangon (1 mentions)
Tween20, by New England Biolabs (1 mentions)
Nh4 2so4, by New England Biolabs (1 mentions)
Guanidine hydrochloride, by Sangon (1 mentions)
Mgso4, by New England Biolabs (1 mentions)
Tween 20, by Sangon (1 mentions)
Exicycler 96 real time quantitative thermal block, by Bioneer (1 mentions)
Beyort 2 m mlv reverse transcriptase kit, by Beyotime (1 mentions)
Exicycler 96, by Bioneer (1 mentions)
Beyort 2 m mlv reverse transcriptase, by Beyotime (1 mentions)
Tripure, by BioTeke (1 mentions)
3 protocols using sybr green dye
1
Isothermal DNA Amplification Reagent Mix
2
Quantitative analysis of iNOS and Arg1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extracted from the ischemic penumbra was reverse-transcribed into cDNA with a BeyoRT II M-MLV reverse transcriptase kit (Beyotime Biotech Inc., Shanghai, China). Real-time PCR
amplifications were conducted with SYBR Green dye (Solarbio Life Sciences) and analyzed with an ExicyclerTM 96 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea). The
mRNA level of each gene was normalized by GAPDH, and the data were analyzed using the 2−ΔΔCT method. The primer sequences were as follows: forward,
5′-TTGGAGCGAGTTGTGGATTG-3′, and reverse, 5′-GTGAGGGCTTGGCTGAGTGA-3′, for inducible nitric oxide synthase (iNOS); forward, 5′-GGAAGACAGCAGAGGAGGTG-3′, and reverse,
5′-TCAGTCCCTGGCTTATGGTT-3′, for arginase-1 (Arg1).
amplifications were conducted with SYBR Green dye (Solarbio Life Sciences) and analyzed with an ExicyclerTM 96 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea). The
mRNA level of each gene was normalized by GAPDH, and the data were analyzed using the 2−ΔΔCT method. The primer sequences were as follows: forward,
5′-TTGGAGCGAGTTGTGGATTG-3′, and reverse, 5′-GTGAGGGCTTGGCTGAGTGA-3′, for inducible nitric oxide synthase (iNOS); forward, 5′-GGAAGACAGCAGAGGAGGTG-3′, and reverse,
5′-TCAGTCCCTGGCTTATGGTT-3′, for arginase-1 (Arg1).
3
Quantifying mRNA Levels in Inflammatory Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The messenger RNA (mRNA) levels of tumor necrosis factor‐α (TNF‐α), interleukin‐6 (IL‐6), and TMUB1 were determined by qRT‐PCR. Total RNAs were prepared using TRIpure (BioTeke, China) and reverse‐transcribed using BeyoRT II M‐MLV reverse transcriptase (Beyotime, China). Quantitative PCR was performed using SYBR Green dye (Solarbio, China) to measure amplification on a fluorescence quantitative PCR instrument (Exicycler 96, Bioneer). The sequences of primers were as follows (5′–3′): IL‐6 forward (mus): ATGGCAATTCTGATTGTATG, and reverse (mus): GACTCTGGCTTTGTCTTTCT; TMUB1 forward (mus): GTAGGCGATGAGGTGACTGT, and reverse (mus): GCTGTGCTGGTGTTGTGG; TNF‐α forward (mus): CAGGCGGTGCCTATGTCTCA, and reverse (mus): GCTCCTCCACTTGGTGGTTT; TMUB1 forward (Homo): CCTCGTGCTACGGCTGAAA, and reverse (Homo): GTTGGGAGGGAGGTGAAGG; IL‐6 forward (homo): GTCCAGTTGCCTTCTCCC, and reverse (Homo): GCCTCTTTGCTGCTTTCA; TNF‐α forward (Homo): GAGTGACAAGCCTGTAGCC, and reverse (Homo): AAGAGGACCTGGGAGTAGAT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!