HEK293 cells (Cell Biolabs, Inc., Chicago, IL, USA) were lysed in immunoprecipitation (ip) buffer (20 mmol/L Hepes, 120 mmol/L NaCl, 1% Triton-X100) containing protease and phosphatase inhibitors (Thermo Fisher Scientific). IP was performed by incubating 500 mg of whole-cell lysates (INPUT) with the indicated antibodies (listed in Table S4 ) for 12 h at 4 °C. Mouse or rabbit IgG were used as controls for non-specific co-immunoprecipitation. The following day, protein A- or G- beads (Sigma–Aldrich, St. Louis., MO, USA) were added to lysates and incubated for 6 h at 4 °C. The immuno-complexes were then washed thrice with lysis buffer, re-suspended in SDS sample buffer (Life Technologies, Frederick, MD, USA), and processed for Western blotting.
Hek293 cells
Manufactured by Cell Biolabs
Sourced in United States
HEK293 cells are a widely used cell line derived from human embryonic kidney cells. They are a common tool for various research applications, including gene expression, protein production, and virus propagation.
Automatically generated - may contain errors
Lab products found in correlation
Sds sample buffer, by Thermo Fisher Scientific (1 mentions)
Protease and phosphatase inhibitor, by Thermo Fisher Scientific (1 mentions)
Protein a or g beads, by Merck Group (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Benzonase nuclease, by Merck Group (1 mentions)
Phelper, by Cell Biolabs (1 mentions)
Pcrii blunt topo vector, by Thermo Fisher Scientific (1 mentions)
Paav2 5, by Cell Biolabs (1 mentions)
3 protocols using hek293 cells
1
Immunoprecipitation of HEK293 cell lysates
2
Caco-2 Cell Culture for Uptake Studies
3
Generation of AAV Expressing Mouse MHCI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We produced the plasmid and AAV as described previously [17] . Brie y, cDNA for mouse MHCI was ampli ed by polymerase chain reaction (PCR) from a mouse brain cDNA library using speci c primers (sH-2D forward primer, ATGAATTCGCCGCCATGGGGGCGATGGC; sH-2D reverse primer, ATGTCGACCCATCTCAGGGTGAGGGGCT), and inserted into a pCRII-blunt TOPO vector (Invitrogen, Carlsbad, CA, USA). cDNA was subcloned into the EcoRI site of the expression vector pCAGGS-HA, which was a gift from Dr. Kozo Kaibuchi. In the AAV vector, pZac2.1 gfaABC1D-EGFP-P2A-sH-2D was generated by replacing EGFP-P2A-sH-2D in tdTomato in pZac2.1-gfaABC1D-tdTomato, which was donated by Dr. Baljit Khakh (Addgene plasmid # 44332). AAV vectors were prepared as described previously [17, 28] . Brie y, plasmids for the AAV vector, pHelper (Cell BioLabs Inc., San Diego, CA), and pAAV-2/5 (Cell BioLabs Inc.) were transfected into HEK293 cells (Cell BioLabs, Inc.) using Lipofectamine 2000 (Invitrogen). After a 3-day incubation, cells were collected and lysed by freeze and thaw cycles. Cell lysates were incubated with benzonase nuclease (Millipore, Darmstadt, Germany). Cell debris was removed by centrifugation at 10,000 x g at room temperature for 10 min. Supernatants were used as the primary virus. AAV titers were estimated via a quantitative polymerase chain reaction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!