Cells were dissolved by Radio-Immunoprecipitation Assay (RIPA) buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets. The concentration of total protein was determined using the BCA protein assay kit. The cell lysate was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto PVDF membranes. The membranes were then incubated with the following primary antibodies: HRP-conjugated monoclonal anti-phospho-tyrosine antibody (1:5000), and anti-actin monoclonal antibody (1:3000). Subsequently, the membranes were incubated with HRP-conjugated secondary antibody (1:5000) and the immunoreactive bands were visualized by SuperSignal West Pico Chemiluminescent Substrate using Amersham Imager 6000.
Amersham imager 6000
Manufactured by Cytiva
The Amersham Imager 6000 is a versatile, high-performance imaging system designed for a wide range of life science applications. It offers advanced imaging capabilities, including chemiluminescence, fluorescence, and densitometry, providing researchers with a comprehensive tool for their laboratory workflows.
Automatically generated - may contain errors
3 protocols using amersham imager 6000
1
Western Blot Analysis of Phosphorylated Proteins
2
Protein Extraction and Western Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole cell extract was obtained from cell pellets by extraction in SC buffer (50 mM Tris-HCl pH 8.0, 170 mM NaCl, 0.1% NP40, Complete EDTA-free protease inhibitor cocktail (Sigma-Aldrich, 11873580001)). Protein isolation from tissue samples was performed with RIPA buffer (1 mM EDTA, 50 mM Tris-HCl pH 7.5, 0.1% SDS, 150 mM NaCl, 1% NP40, 1% Sodium deoxycholate, Complete EDTA-free protease inhibitor cocktail). Tissues were lysed by Minilys personal homogenizer (Bertin Corp.). Western blot analyses were performed as described24 (link). Membranes were decorated using antibodies directed against: Lsd1 (Custom-made, Biogenes, 3544, 1:1000), Tubulin (Sigma-Aldrich, T6074, 1:10,000), FlagM2 (Sigma-Aldrich, F3165, 1:2000), Ucp1 (Abcam, ab10983, 1:500), Myhfast (Sigma-Aldrich, M4276, 1:1000), Gapdh (Santa Cruz, sc-47724, 1:5000), or Glis1 (Abcam, ab135724, 1:200). Western blot results were quantified using an Amersham Imager 6000 and Melanie 2D Gel Analysis Software.
3
DNA Binding Capacity of Polydopamine Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA binding capacity of P and DPs were detected by agarose gel electrophoresis, where CpG 1826 (TCCATGACGTTCCTGACGTT, GenScript, China) served as DNA. Details were: PDA NPs (100 μg) were added into CpG 1826 solution (1 μM in PBS, 2 mL) and incubated at room temperature (2 h). Then, the mixture (10 μL) was loaded on 2% agarose gel and the gel electrophoresis was implemented at 100 V for 40 min. Pure CpG 1826 was used as the control. And then the agarose gel was pre-stained with SuperRed/GelRed and imaged by Ultra-sensitive multifunctional imager (Amersham Imager 6000). Besides, the DNA ladder (50–1500 bp, Ameko Life sciences, China) was applied as the DNA template to investigate the binding ability of DPs. Briefly, DNA ladder (5 μL) was mixed with different PDA NPs (50 μg/mL, 10 μL) or DP-B(H) with different concentration (0, 10, 20, 50 and 100 μg/mL, 10 μL) for 2 h before implementing DNA gel electrophoresis (3% agarose gel, 100 V, 40 min). Furthermore, to confirm their DNA binding ability not affected by serum, the DNA ladder (5 μL) was initially mixed with 5 μL serum from SD rats for 10 min, and then respectively mixed with PDA NPs (50 μg/mL, 10 μL) for 2 h. Finally, the supernatant after centrifuge (500 ppm, 5 min) was collected for DNA gel electrophoresis (3% agarose gel, 100 V, 40 min).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!