Primestar gxl kit
The PrimeSTAR GXL kit is a high-fidelity DNA polymerase system designed for accurate and efficient DNA amplification. It features a DNA polymerase with enhanced proofreading ability, providing superior accuracy and longer amplicon lengths compared to standard Taq polymerases.
7 protocols using primestar gxl kit
ASFV DNA Amplification and Sequencing
Cloning and Sequence Alignment of ORFs
BTV Identification via cox1 Gene Amplification
Sex-specific PCR for Molecular Sexing
Robust Amplification of DNA Sequences
Validating Candidate Mobile Genetic Elements
Quantitative RT-PCR analysis of MTM1
(AGAATGGATAAGTTTTGGAC / TTATTTCGAGCTCTAATGCG) for fragment 3 (622nt).
For quantitative PCR, cDNAs were diluted 1/20 and amplification conducted using SYBR Green (Applied Biosystems) with the F3/R3 primer set under conditions of maximal efficiency on an ABI2400 quantitative thermocycler. Data analysis was carried out using the comparative ΔCt method using the L32 ribosomal gene as a housekeeping gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!