Sigenome control pool non targeting

For RNA interference, HK2 cells were plated in 24‐well plate and then transfected with siRNA using Lipofectamine RNAiMax (Thermo Fisher Scientific). For each well to be transfected was first prepared the RNAi duplex‐Lipofectamine RNAiMax complexes as follows: 6 pmol of RNAi duplex were diluted in 100 μl Opti‐MEM I Medium without serum in the well of the culture plate and gently mixed. Then, 1 μl Lipofectamine RNAiMax was added to each well containing the diluted RNAi molecules, gently mixed and incubated for 20 min at room temperature under sterile conditions. In that time, cells were detached, counted and diluted in complete growth medium without antibiotics so that 500 μl contains the appropriate number of cells to give 30% confluence 24 h after plating. After the 20 min of incubation at room temperature to each well with RNAi duplex, Lipofectamine RNAiMax complexes were added 500 μl of the diluted cells. This gives a final volume of 600 μl and a final RNA concentration of 10 nM. The 24well‐plate was gently mixed gently by rocking and incubated 24–72 h at 37°C in a CO₂ incubator.
The siRNA targeting VPS35 was from Sigma (5′ CTGGACATATTTATCAATATA 3′; 3′ TATATTGATAAATATGTCCAG 5′). It was used at 10 nM final concentration. Control cells were treated with identical concentrations of siGENOME Control Pool Non‐Targeting from Dharmacon (D‐001206‐13‐05).