Taq dna polymerase

Plasma samples were centrifuged at 4°C at 16,000×g for 5 min to remove cell debris. The supernatant was diluted in sterile nuclease-free water at a 1:40 ratio for direct quantitative polymerase chain reaction (qPCR) measurement. The diluted plasma samples were stored at −20°C until they were analyzed. The cell free DNA (cfDNA) concentrations of the plasma were quantified using direct qPCR and a primer set (Table 1), producing an 88-bp fragment of the chromosomal myostatin (MSTN) amplicon [13 (link)]. Acting as a template, the diluted plasma was added to master mixer 20X Evagreen (SolGent, Seoul, Korea) containing 10 pmol primer set, 25 mM MgCl₂, 10 mM dNTPs, and 0.5 U BIOFACT Taq DNA polymerase (BIOFACT, Seoul, Korea). Amplification was completed over 40 cycles.

Genomic DNA was extracted from 20 mg of brain tissue sample using a HiYield genomic DNA mini kit (Real Biotech Corporation, Banqiao Taiwan). Polymerase chain reaction (PCR) was carried out to amplify the bovine IFITM3 gene using BioFACT™ Taq DNA Polymerase (BioFACT, Daejeon, Korea). Information on bovine IFITM3 gene-specific primers and experimental conditions is provided in Table 1. The PCR mixture contained 2.5 µL of 10× Taq DNA polymerase reaction buffer, 1 µL of genomic DNA, 10 pmol of each primer, 0.5 µL of a 0.2 µM dNTP mixture, 0.2 µL of 0.04 units of Taq DNA polymerase, and sterile deionized water in a total volume of 25 µL. PCR amplicons were directly sequenced by using an ABI 3730 sequencer (ABI, Foster City, California, USA), and sequencing electropherograms were visualized by using Finch TV software (Geospiza, Inc., Seattle, WA, USA).

Genomic DNA was isolated from whole blood samples of 204 dogs using a Hi Yield Genomic DNA Mini Kit (Real Biotech Corporation, Taipei, Taiwan) and a Bead Genomic DNA Prep Kit (Biofact, Daejeon, Korea) following the manufacturer’s instructions. PCR was carried out using gene-specific sense and antisense primers: canine PRNP-F (TGTGCAGATGTTCTCGCTGT) and canine PRNP-R (GAAGCGGGAATGAGACACCA). These primers were designed to amplify the entire ORF region of the canine PRNP gene. We performed PCR using BioFACT™ Taq DNA Polymerase (Biofact, Daejeon, Korea). The 25 µL PCR mixture was composed of 5 µL of 10× DNA polymerase buffer, 2.5 units of 10× Taq DNA polymerase, 1 µL of genomic DNA, 10 pmol of each primer, and 0.5 µL of a 0.2 M dNTP mixture. The PCR conditions were as follows: denaturing at 95 °C for 2 min, followed by 34 cycles of 95 °C for 20 s, 62 °C for 30 s, and 72 °C for 1 min, and 30 s and 1 cycle of 72 °C for 5 min. All PCR products were analyzed by electrophoresis on a 1.0% agarose gel stained with ethidium bromide (EtBr). PCR products were directly sequenced using an ABI 3730 sequencer (ABI, Foster City, California, USA). Sequencing results were read using Finch TV software (Geospiza Inc, Seattle, WA, USA).