cDNA was synthesize from purified RNA using primer that binds the poly A tail (3CDS_dT_Anchored_30 AAG CAG TGG TAT CAA CGC AGA GTA CTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TVN) and a Template Switching Oligo primer (TSO_sCellRNAseq /5bioeg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) The poly-A anchor primer was mixed in a master mix of 2 mM dNTP (Thermo Scientific R0192), 8 U/μl RNAseOut (Thermo Scientific EO0381), and nuclease-free water (Ambion AM9937). 0.5 μg of RNA samples were mixed with this master mix and incubated for 1 min at room temperature. After incubation, the samples were heated at 72 °C for 3 minutes to denature any secondary RNA structures. Samples were cooled on ice before mixed with x1 Reverse Transcription buffer (Thermo Scientific EP0742), 20 mM DTT (Sigma 646563–10X.5ML), 1M betaine (Sigma B0300–1VL), 20 mM MgCl2 (Invitrogen AM9530G), 20 μM TSO primer, 8 U/μL RNase-Inhibitor (Thermo Scientific EO0381), and 40 U/μL Reverse Transcriptase (Thermo Scientific EP0752). Samples were run in a thermal cycler (Eppendorf Master Cycler epgradient) with the following protocol: initial step of 30 min at 50 °C, 10 cycles of 50 °C for 2 min, 42 °C for 2 min, an Inactivation step of 80 °C for 15 min, then hold at 4 °C. Synthesized cDNA was purified using x0.8 total volume of AmpureXP beads (Beckman Coulter A63881) and eluted in nuclease-free water.
Am9530g
Manufactured by Thermo Fisher Scientific
The AM9530G is a laboratory instrument designed for DNA amplification. It features a compact size and supports a range of sample volumes and plate formats to accommodate various experimental needs.
Automatically generated - may contain errors
Lab products found in correlation
Am9640g, by Thermo Fisher Scientific (3 mentions)
Am9260g, by Merck Group (3 mentions)
Ultrapure dnase rnase free water, by Thermo Fisher Scientific (2 mentions)
Suc507, by Avantor (2 mentions)
T8787 50ml, by Thermo Fisher Scientific (2 mentions)
Np 40, by Thermo Fisher Scientific (2 mentions)
Am9937, by Thermo Fisher Scientific (1 mentions)
R0192, by Thermo Fisher Scientific (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Mastercycler ep gradient, by Eppendorf (1 mentions)
Purexpress in vitro protein synthesis kit, by New England Biolabs (1 mentions)
Nuclease free water, by Thermo Fisher Scientific (1 mentions)
Protector rnase inhibitor, by Roche (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
Protector rnase inhibitor, by Merck Group (1 mentions)
Am9260g, by Thermo Fisher Scientific (1 mentions)
Am9759, by Thermo Fisher Scientific (1 mentions)
Unmodified oligonucleotides, by Integrated DNA Technologies (1 mentions)
Am9855g, by Thermo Fisher Scientific (1 mentions)
Amicon ultra centrifugal filter, by Merck Group (1 mentions)
12 protocols using am9530g
1
cDNA Synthesis from Purified RNA using Template Switching
2
In Vitro Protein Synthesis Protocol
3
NASBA-Based RNA Amplification and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For target RNA amplification with NASBA, 2.01 μL 3X reaction buffer (Life Sciences, NEC-1-24;), 0.99 μL 6X nucleotide mix (Life Sciences, NEC-1-24), 0.03 μL Protector RNase Inhibitor (Roche), 0.12 μL of each NASBA primer (12.5 mM, IDT), 0.15 μL nuclease-free water (Thermo Fisher, 10977015), and 1.2 μL target RNA were mixed at 4°C and heated to 65°C for 2 min, followed by a 10-minute incubation at 41°C. 1.5 μL Enzyme Mix (Life Sciences, NEC-1-24) was then added to the reaction for a final volume of 6 μL. After mixing, the reaction was incubated at 41°C for 2 hours. For a 35 μL two-pot reaction, 5 μL of the NASBA amplified RNA product was combined with 0.7 μL of RNA aptaswitch and 10X DFHBI-1T dye mix. This reaction was incubated and measured at 37 °C for an additional 2 hr. The 10X DFHBI-1T dye mix consists of 40 μM DFHBI-1T (Lucerna, 410), 40 mM HEPES (Gibco™, 15630080), pH 7.4, 100 mM KCl (Invitrogen™, AM9640G), and 5 mM MgCl2 (Invitrogen™, AM9530G).
4
Transposase Activity Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The activity of the assembled T7-Tn5 and Tn5 transposase was checked as described below. The mixture of 10 µL of 2× TD buffer (20 mM Tris-HCl at pH 7.6 [Invitrogen 15568-025], 10 mM MgCl2 [Invitrogen AM9530G], 20% dimethyl formamide), 50 ng human genomic DNA (Promega G304A), 2 µM assembled T7-Tn5 transposase or Tn5 transposase was incubated for 7 min at 55°C. After incubation, the mixture was purified by a Qiagen MinElute PCR purification kit (Qiagen 28004) and eluted in 10 µL of elution buffer. Then eluted DNA was mixed with 2 µL 6× loading dye and run on a 1.2% agarose gel to check the length distribution of the DNA.
5
Single-Nucleus RNA Sequencing of Frozen Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pilot single-nucleus RNA sequencing experiment was undertaken to compare single-cell versus single-nuclear results from a matched sample. The biopsy from a 58-year-old male was collected fresh and divided into 8 segments, evenly distributed to be processed fresh for single cell RNA sequencing as above, and the remainder was flash frozen in liquid nitrogen. The sample was later retrieved from liquid nitrogen and processed on dry ice according to the protocol in88 (link) with a lysis buffer containing: 0.32 mM sucrose (BioShop SUC507.1), 5 mM CaCl2 (VWR, 97062-820), 3 mM MgCl2 (Thermo Fisher AM9530G), 20 mM Tris-HCl pH 7.5 (Thermo Fisher, 15567027), 0.1% TritonX-100 (Sigma Aldrich T8787-50ML), 0.1 mM EDTA pH 8.0 (Thermo Fisher AM9260G), 40 U/ml Protector RNAse inhibitor (Sigma Aldrich 3335399001) in UltraPure DNAse/RNAse-free water (Thermo Fisher 10977015). The nuclei were captured and sequenced using 10X Genomics Single Cell 3’ v3 Reagents as above.
6
DNA Origami Structures Assembly
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA origami structures
were assembled in a single folding reaction carried out in a test
tube (AB0620, ThermoFisher Scientific) with 10 μL of folding
mixture containing 10 nM M13mp18 scaffold DNA (New England Biolabs),
100 nM unmodified oligonucleotides (Integrated DNA technologies),
either 100 nM biotin-modified oligonucleotides (Biomers) for direct
hybridization to the DNA origami tile (H57-dSAv-NL, H57-tSAv-NL) or
500 nM biotinylated oligonucleotides (Biomers) for external hybridization
(H57-dSAv, H57-tSAv) and folding buffer (5 mM Tris (AM9855G, ThermoFisher
Scientific), 50 mM NaCl (AM9759, ThermoFisher Scientific), 1 mM EDTA
(AM9260G, ThermoFisher Scientific), 12.5 mM MgCl2) (AM9530G, ThermoFisher
Scientific)). Oligonucleotide sequences are shown in the Supporting
Information Appendix,Tables S13–S15 . At the site chosen for ligand attachment, a staple strand was elongated
at its 3′-end with 21 bases (H57-DNA, H57-PNA, H57-mSAv, H57-dSAv,
H57-tSAv). At sites chosen for cholesterol anchor attachment, staple
strands were elongated at the 5′-end with 25 bases, respectively.
DNA origami were annealed using a thermal protocol (90 °C, 15
min; 90 °C – 4 °C, 1 °C min–1; 4 °C, 6 h) and purified using 100 kDa Amicon Ultra centrifugal
filters (UFC510096, Merck). DNA origami were stored up to 4 weeks
at −20 °C.
were assembled in a single folding reaction carried out in a test
tube (AB0620, ThermoFisher Scientific) with 10 μL of folding
mixture containing 10 nM M13mp18 scaffold DNA (New England Biolabs),
100 nM unmodified oligonucleotides (Integrated DNA technologies),
either 100 nM biotin-modified oligonucleotides (Biomers) for direct
hybridization to the DNA origami tile (H57-dSAv-NL, H57-tSAv-NL) or
500 nM biotinylated oligonucleotides (Biomers) for external hybridization
(H57-dSAv, H57-tSAv) and folding buffer (5 mM Tris (AM9855G, ThermoFisher
Scientific), 50 mM NaCl (AM9759, ThermoFisher Scientific), 1 mM EDTA
(AM9260G, ThermoFisher Scientific), 12.5 mM MgCl2) (AM9530G, ThermoFisher
Scientific)). Oligonucleotide sequences are shown in the Supporting
Information Appendix,
at its 3′-end with 21 bases (H57-DNA, H57-PNA, H57-mSAv, H57-dSAv,
H57-tSAv). At sites chosen for cholesterol anchor attachment, staple
strands were elongated at the 5′-end with 25 bases, respectively.
DNA origami were annealed using a thermal protocol (90 °C, 15
min; 90 °C – 4 °C, 1 °C min–1; 4 °C, 6 h) and purified using 100 kDa Amicon Ultra centrifugal
filters (UFC510096, Merck). DNA origami were stored up to 4 weeks
at −20 °C.
7
Preparation of High Salt Buffer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare the high salt buffer, 7.5 mL of 2 M KCl (RNase free; Fisher Scientific, #AM9640G), 2.5 mL of 1 M Tris (pH 7.4; ThermoFisher Scientific, #17,926), 600 µl of 1 M MgCl2 (Rnase free; Fisher Scientific, #AM9530G), and 500 µl of NP-40 (ThermoFisher Scientific, #28,324) were added in a 50 mL Falcon tube. The final volume was made up to 50 mL with DNase/RNase free water and vortexed to completely dissolve all contents. The high salt buffer supplemented (HSB-S) was prepared fresh prior to the washing step by adding together 10 µL of protease inhibitor (VWR, #97,063–970), 40 µl of cycloheximide (5 mg/ml; Fisher Scientific, #AC357420050) and 5 µL of RNasin (VWR, #PAN2615) in a 2 mL Eppendorf tube and the volume was adjusted to 2 mL with HSB.
8
ssDNA Aptamer Library Synthesis and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ssDNA aptamer library was synthesized and HPLC-purified by IDT, with 40 nucleotide random bases flanked by 20 nucleotide primer ends required to perform PCR amplification (forward fixed region: TCGCACATTCCGCTTCTACC, reverse fixed region:
CGTAAGTCCGTGTGTGCGAA). The starting library was designed with a A:C:G:T molar ratio of 3:3:2:2.4 to adjust for equimolar amounts of nucleotide incorporation. Primers used included: forward primer, TCGCACATTCCGCTTCTACC; 5'-biotinylated forward primer, /5bio/TCGCACATTCCGCTTCTACC; 5'-FAM-labeled forward primer, /5FAM/TCGCACATTCCGCTTCTACC; reverse primer, TTCGCACACACGGACTTACG; 5'phosphorylated reverse primer, /5Phos/TTCGCACACACGGACTTACG. Wash buffer was prepared with 5 mM MgCl 2 (Thermo Fisher, AM9530G) and 4.5 g/L glucose (RPI, G32040) in DPBS. Binding buffer was prepared with 100 mg/mL of yeast tRNA (Thermo Fisher, AM7119) and 1 mg/mL of bovine serum albumin (RPI, A30075).
CGTAAGTCCGTGTGTGCGAA). The starting library was designed with a A:C:G:T molar ratio of 3:3:2:2.4 to adjust for equimolar amounts of nucleotide incorporation. Primers used included: forward primer, TCGCACATTCCGCTTCTACC; 5'-biotinylated forward primer, /5bio/TCGCACATTCCGCTTCTACC; 5'-FAM-labeled forward primer, /5FAM/TCGCACATTCCGCTTCTACC; reverse primer, TTCGCACACACGGACTTACG; 5'phosphorylated reverse primer, /5Phos/TTCGCACACACGGACTTACG. Wash buffer was prepared with 5 mM MgCl 2 (Thermo Fisher, AM9530G) and 4.5 g/L glucose (RPI, G32040) in DPBS. Binding buffer was prepared with 100 mg/mL of yeast tRNA (Thermo Fisher, AM7119) and 1 mg/mL of bovine serum albumin (RPI, A30075).
9
Single-Nucleus RNA Sequencing Pilot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pilot single-nucleus RNA sequencing experiment was undertaken to compare single cell versus single nuclear results from a matched sample. The biopsy was collected fresh and divided into 8 segments, evenly distributed to be processed fresh for single cell RNA sequencing as above, and the remainder was flash frozen in liquid nitrogen. The sample was later retrieved from liquid nitrogen and processed on dry ice according to the protocol in 74 with a lysis buffer containing: 0.32 mM sucrose (BioShop SUC507.1), 5 mM CaCl2 (VWR, 97062-820), 3 mM MgCl2 (Thermo Fisher AM9530G), 20 mM Tris-HCl pH 7.5 (Thermo Fisher, 15567027), 0.1% TritonX-100 (Sigma Aldrich T8787-50ML), 0.1 mM EDTA pH 8.0 (Thermo Fisher AM9260G), 40 U/ml Protector RNAse inhibitor (Sigma Aldrich 3335399001) in UltraPure DNAse/RNAse-free water (Thermo Fisher 10977015). The nuclei were captured and sequenced using 10X Genomics Single Cell 3' v3
Reagents as above.
Reagents as above.
10
Tn5 Tagmentation of cDNA Libraries
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!