Luc2p mRNA expression levels were analyzed in triplicate by qRT-PCR using a custom firefly luciferase luc2p TaqMan assay: probe (5′ ACAACCAGCGCCATTC 3′) and primers (forward — 5′ GGCTACGGCCTGACAGAA 3′ reverse — 5′ CTGCGCCAGGCTTGTC 3′) in Type-it™ Fast SNP PCR Master Mix (Qiagen) using a 7900HT Fast Real-Time PCR System (Life Technologies). 25 ng template cDNA was used for each reaction and relative abundances were calculated by ΔΔCT method using GAPDH as the reference gene. Comparative threshold cycle (CT) values were calculated using SDS 2.2 software (Life Technologies).
Type it fast snp pcr master mix
Manufactured by Qiagen
Sourced in Germany
The Type-it™ Fast SNP PCR Master Mix is a ready-to-use solution designed for the amplification of single nucleotide polymorphisms (SNPs) in real-time PCR. The mix contains all the necessary components, including a fast-activating hot-start DNA polymerase, for efficient and reliable SNP detection.
Automatically generated - may contain errors
Lab products found in correlation
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 4 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Geneamp pcr system, by Thermo Fisher Scientific (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
3 protocols using type it fast snp pcr master mix
1
Quantifying Luc2p mRNA Expression
2
Quantification of HTRA1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA (∼200 ng) from human eye tissues were used as template for reverse transcription using the SuperScript IV First-Strand Synthesis kit (Thermo Fisher Scientific) and the HTRA1 gene–specific R6 primer (R6:GGGCGATCTTCTCCACCACG). Approximately 20 ng cDNA product or 20 ng gDNA was used as template for PCR. A master mix containing 300 nM of each primer (F6:AGAGTCGCCATGCAGATCC and R4:TGGCGCACACACAGAGGC) and 2X FailSafe buffer J master mix (Illumina) was added to the template. Seven cycles of PCR were performed with a 61 °C annealing temperature. A second round of nested PCR was performed using 5 µl product from the first round and the custom Taqman SNP assay for rs1049331 (SI Appendix, Table S1 ). PCR was performed using the Type-It Fast SNP PCR master mix (Qiagen) on the RainDance RainDrop digital droplet PCR system. The percentage of droplets with a 2'-chloro-7'phenyl-1,4-dichloro-6-carboxy-fluorescein (VIC) versus a 6-carboxyfluorescein (FAM) fluorescent signal was quantified using the RainDrop software package.
3
Genotyping of PAI-1 4G/5G Polymorphism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Additional analyses were performed with the PAI-1 4G/5G genotype (rs1799889), a single nucleotide insertion/deletion (4G/5G) polymorphism in the promoter region of the PAI-1 gene. Genotyping was carried out using a MGB-NFQ primer/probe Taqman assay on a geneamp PCR system (Applied Biosystems, Foster City, CA, USA). DNA was diluted to 10 ng lL À1 and plated in 384-well plates. For the PCR reaction, the Type-it Fast SNP PCR Master Mix (Qiagen, Hilden, Germany) was used with the following primers and probes: forward primer 5 0 -AGACAAGGTT GTTGACACAAGAGA-3 0 , reverse primer 5 0 -GGCC GCCTCCGATGATAC-3 0 , 4G-allele probe 5 0 (VIC)-C GGCTGACTCCCCAC(NFQ)-3 0 , 5G-allele probe 5 0 (FAM)-CGGCTGACTCCCCCAC(NFQ)-3 0 . Fluorescence endpoint reading for allelic discrimination was performed with an ABI Prism 7900 HT Sequence Detection System with SDS 2.1 software for genotype clustering (Applied Biosystems). A DNA sample was available from 615 individuals, genotyping failed for nine of the DNA samples.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!