Pcdna6.2 gw emgfp vector

Pre-miR-5701 expression vectors and control vector were chemically synthesized in the pcDNA6.2-GW/EmGFP vector (Invitrogen, Carlsbad, CA, USA). The overexpressed plasmid of FGFR2, miR-5701 inhibitor, and all siRNA (i.e., siDNMT3A, siHDAC3, and siMBD1) were purchased from the GenePharma Corporation (SGC, Shanghai, China). The FGFR2 wild-type and mutated mRNA were cloned in between the SacI and XhoI sites of the pmirGLO expression vector (Invitrogen, Carlsbad, CA, USA). All related sequences used are listed in the Supplementary Table 2. The SGC-7901 cells were treated with 5-Aza (2.5, 5, 7.5, 10, and 15 μM; MedChemExpress, Shanghai, China) for 3 days and TSA (100, 300, 500, 700, and 900 nM; MedChemExpress, Shanghai, China) for 24 h. Then, the total RNA was extracted using the TRIzol protocol.

The miR-638 expression vector (pre-miR-638) and control vector were constructed with synthetic oligonucleotides and cloned in between the 5′ EcoRI and 3′ HindIII sites of the pcDNA6.2-GW/EmGFP vector (Invitrogen) according to the manufacturer's instructions. We also commercially synthesized 2′-O-methyl-modified antisense oligonucleotide of miR-638 was used as miR-638 inhibitor (named anti-miR-638). The sequence of anti-miR-638: 5′-AGGCCGCCACCCGCCCGCGATCCCT-3′. The sequence of negative control (anti-miR-NC) was: 5′-TGACTGTACTGAACTCGACTG-3′. The 3′ UTR of human VEGFA mRNA was constructed by synthetic oligonucleotides and cloned in between the SacI and XhoI sites of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega).

The resuspended cells were cultured in 6-well culture plates for 24 hours, and the cells were then re-cultured in antibiotic-free and serum-free RPMI-1640 medium for at least 8 hours before TNF-α incubation. The cells were transiently transfected with Turbofect Transfection Reagent (Roche, SC). The shRNA duplexes were designed against VASP (GenBank accession no. BC038224) with the following sequences: 5′-TGCTGTAAAGCATCACAGTGGCCCGGGTTTTGGCCACTGACTGACCCGGGCCAGTGATGCTTTA -3′ and were inserted into the pcDNA6.2-GW/EmGFP vector (Invitrogen, USA) to make pcDNA6.2-GW/EmGFP-miR-VASP. The siRNA duplex oligonucleotides to HIF-1α (GenBank accession no. NM_001530) were synthesized by Shanghai GenePharma (Shanghai, China). The sequence for HIF-1a-siRNA was as follows: 5′-CUGAUGACCAGCAACUUGAdTdT -3′. A scrambled-siRNA (5′- AGUUCAACGACCAGUAGUCdTdT-3′) was used in all experiments. Scrambled shRNA was obtained from Invitrogen and used as a negative control in all experiments. After 8–9 hours, the transfection reagent was removed. Medium with antibiotic and serum was added to the plates, and the cells were sequentially cultured for 24 hours.