Takara pcr thermal cycler dice

Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was conducted as described previously [26 (link),28 (link)]. Total RNA was extracted from cultured cells or tissues using TRIzol and reverse transcribed to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems/Thermo Fisher Scientific, Foster City, CA, USA). The synthesized cDNA was analyzed by kinetic real-time PCR using Takara PCR Thermal Cycler Dice (Takara Bio Inc., Kusatsu, Japan) with Platinum® SYBR® Green qPCR Supermix (Invitrogen/Thermo Fisher Scientific) [16 (link)]. The primer sequences are listed in Supplementary Table 1.

Chondrocytes were treated with 25 and 50 ng/ml IL-1β for 24 h. Thereafter, total RNA was isolated from the chondrocytes using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The concentration of the isolated total RNA was measured using a Nanodrop 2000 (ThermoFisher Scientific). To synthesize cDNA, 1 µg RNA was reverse transcribed using a ThermoScript reverse transcription-PCR system (Invitrogen) according to the manufacturer’s instructions. For qRT-PCR, cDNA was amplified using an Eco Real-Time PCR system (illumine Inc., San Diego, CA, USA). Relative gene expression was determined using the ^ΔΔCT method, as detailed by the manufacturer (illumine Inc.). β-actin was used as the internal control. qPCR was performed using 2× TOPsimple DyeMIX-nTaq (Enzynomics, Seoul, Korea) and specific primers on a TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio Inc., Shiga, Japan). Thereafter, the PCR products were electrophoresed on an agarose gel to determine the expression level of the target genes. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences and the conditions used are summarized in Table 1.

The relative amounts of Cx43 mRNA and vascular cell adhesion molecule-1 (VCAM-1) in the kidneys were measured by real-time PCR on TaKaRa PCR Thermal Cycler Dice Real Time System Lite (TaKaRa Bio, Inc., Japan). Total RNA was extracted using a TaKaRa MiniBEST Universal RNA Extraction Kit (Code. 9767, TaKaRa Bio, Inc., Japan). The cDNA was synthesized using a primeScript RT reagent Kit with a gDNA Eraser Kit (TaKaRa Code. RR047) on TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio, Inc., Japan). The PCR reaction mixture in a 25 μL volume contained 12.5 μL SYBR Premix Ex Taq II (Code. RR820, TaKaRa Bio, Inc., Japan), 2 μL RT product, 2 μL Primer F/R (each 10 μM) and 8.5 μL dH₂O. The conditions of the PCR reaction: 95°C for 30s, then 95°C for 5s and 60°C for 30s, for 40 cycles. The GAPDH expression level was quantitated as an internal reference. The sequences of the primer used were as follows:
Cx43 Forward: 5’-AGGTCTGAGAGCCTGAACTCTCATT-3’
Reverse: 5’-GGCACTCCAGTCACCCATGT-3’
VCAM-1 Forward: 5’-TTCCGGCATTTATGTGTGTGAAG-3’
Reverse: 5’-GGCACATTTCCACAAGTGCAG-3’
GAPDH Forward: 5’-TGTGTCCGTCGTGGATCTGA-3’
Reverse: 5’-TTGCTGTTGAAGTCGCAGGAG-3’
The standard curve was constructed from series dilutions of template cDNA. The relative expression of mRNAs were calculated after normalizing with GAPDH.

Isolation of total RNA and synthesis of cDNA were performed by the methods described above. PCR was performed on 10 µl of the reaction mixture containing each primer, template cDNA and EmeraldAmp PCR Master Mix using a TaKaRa PCR Thermal Cycler Dice (Takara Bio Inc.). Reactions were performed for 30 cycles of 95°C for 30 s, 55°C for 30 s and 72°C for 30 s after initial denaturing at 95°C for 2 min. The primer sets were as follows: Myd88: 5′‐ACCCCACTCGCAGTTTGTTG‐3′ (forward) and 5′‐TCCTGTTGGACACCTGGAGAC‐3′ (reverse); and Gapdh: 5′‐ACCACAGTCCATGCCATCAC‐3′ (forward) and 5′‐TCCACCACCCTGTTGCTGTA‐3′ (reverse).