Previously described methods with some modifications3 (link) were used to measure the binding of Pop1, Est1 and Est2 to TLC1. Briefly, cells expressing HA-Pop1, Est1-MYC or Est2-MYC were collected from 250 mls of culture grown to OD600nm = 0.5 at 24 °C. Cell lysis was accomplished with glass-beads in TMG100 buffer (10 mM Tris-Cl pH8, 1 mM MgCl2, 10% glycerol, 100 mM NaCl, 0.1 mM EDTA, 0.1 mM DTT). A complete mini EDTA-free protease inhibitor tablet, 20 µls of RNasin Plus RNase Inhibitor (Promega N2618), and 20 µls of SUPERase In RNase Inhibitor (Invitrogen AM2696) were added to 10 mls of TMG100 buffer. For immunoprecipitations, 500 µls of TMG100 plus inhibitors, 0.5% Tween 20 and 10 µls of monoclonal c-MYC antibody (Takara 631206) or anti-HA (Santa Cruz sc-7392) were added to 1 mg of total protein and incubated overnight at 4 °C. Dynabeads protein G (Invitrogen) were equilibrated with TMG100 and 0.5% Tween-20, added to the samples and incubated for 4 h at 4 °C. After three washes with TMG100 and 0.5% Tween-20 and one wash with TMG100, the beads were resuspended in TMG100. The IP and INPUT samples were treated with proteinase K (Thermo Fisher 2546), and RNA was extracted with hot acidic phenol method and ethanol precipitated as described above. RNA samples were DNased with Turbo DNA-free (Invitrogen AM107) and eluted with 50 µls of TE buffer.
Turbo dna free
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, France
Turbo DNA-free is a nucleic acid purification kit designed to remove DNA contamination from RNA samples. It uses a proprietary enzymatic method to efficiently degrade DNA while preserving the integrity of the target RNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (65 mentions)
Trizol, by Thermo Fisher Scientific (45 mentions)
Rneasy mini kit, by Qiagen (42 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (22 mentions)
Iscript cdna synthesis kit, by Bio-Rad (17 mentions)
Nanodrop, by Thermo Fisher Scientific (15 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (14 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (14 mentions)
Tri reagent, by Merck Group (13 mentions)
Superscript 2, by Thermo Fisher Scientific (11 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (11 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (10 mentions)
Rneasy kit, by Qiagen (9 mentions)
Lightcycler 480, by Roche (8 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (8 mentions)
2100 bioanalyzer, by Agilent Technologies (8 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (8 mentions)
Rneasy plant mini kit, by Qiagen (8 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (8 mentions)
359 protocols using turbo dna free
1
Measuring Protein-RNA Binding in Yeast Cells
2
Quantitative RT-PCR for Allele Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from dissected individual midguts and carcasses (all tissue remaining after dissection) using TRIzol reagent (Invitrogen) and genomic DNA was removed using TURBO DNA-free (Invitrogen). Quantitative RT-PCR was performed on an ABI Prism 7300 Sequence Detection System (Applied Biosystems). Primers and Taqman probes (Applied Biosystems) were designed to distinguish over-expressed alleles from endogenous A. gambiae MEK mRNA: MEK-RT forward, 5′CCGAGCAACATTCTTGTAAATAGCAGTGG3′; MEK-RT reverse, 5′AAGCGCTCGGGCGACATATAAC3′; S7 forward, 3′GAAGGCCTTCCAGAAGGTACAGA3′; S7 reverse 5′CATCGGTTTGGGCAGAATG3′; wtMEK probe, 6FAM-GATTCAATGGCCAATTCTTTTGTAGG-MGBNFQ; MEK2/5 probe, 6FAM-GATGAAATGGCCAATGATTTTGTAGG-MGBNFQ; and S7 probe, VIC-AGAAGTTCTCCGGCAAGCACGTCGT-6-carboxytetramethylrhodamine. Amplification conditions were defined as reverse transcription at 48°C for 30 min, AmpliTaq Gold activation at 95°C for 10 min, and then 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min.
3
Quantification of Endogenous nTF Levels
4
Robust RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each aliquot, total RNA was isolated using the Fast RNA Pro Blue Kit (MP Biomedicals, Illkirch-Graffenstaden, France) and the FastPrep-24 instrument, according to the manufacturer’s protocols. Extracted RNA was rigorously treated with TURBO DNA-free (Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions and the absence of DNA genomic contamination was checked by quantitative PCR (qPCR). The quality and quantity of treated RNA were analyzed using a DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA) with an RNA integrity number ≥6 for cDNA library preparation. The rRNA depletion and Illumina libraries were made following the Illumina protocol (High-throughput sequencing facility of the I2BC, Gif sur Yvette, France). The cDNA samples were sequenced using Illumina NextSeq v. NS500446 (High-throughput sequencing facility of the I2BC, Gif sur Yvette, France), yielding, on average, 22.8 × 106 50 nt. paired-end reads (±6.8 × 106 reads).
5
Transcriptional Profiling of traF Introns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To access the splicing transcripts of four traF introns, we screened for female- and male-specific dsRed mRNA. Total RNA of ten virgin females or males from w-, 795G, H, I, J, and K were extracted using the miRNeasy Tissue/Cells Advanced Kits (Qiagen). DNase treatment is done using the TURBO™ DNA-free (Invitrogen), and followed by the cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific™). The genomic DNA (gDNA) was amplified using primers 795.s2F and 795.s2R, and the cDNA was amplified using primers 795.s3F and 795.s1R (Supplementary Table 1 ). The gDNA samples were run on 1% TAE agarose gel, and the cDNA samples were run on a 2% TAE agarose gel.
6
Gonadal RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from all gonadal tissue with 1 mL of TRI-reagent and 6 µl of Polyacryl carrier (Molecular Research Center, Cincinnati, OH) using standard methods from the manufacturer, and pellets were resuspended in 20 µl of nuclease-free water. RNA was quantified by absorbance OD 260:280 ratio using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). RNA quality was assessed when there was adequate sample volume by presence of 18S and 28S ribosomal RNA bands using gel electrophoresis. All RNA was DNase treated (Turbo DNA-free, Invitrogen, Waltham, MA) to eliminate genomic DNA, then re-quantified and diluted to 100 ng/µl unless concentrations were already below 100 ng/µl. The size of the gonadal tissue samples varied based on the age and size of the fish so the quantity of RNA extracted varied among individuals. Therefore, a range of 0.4 to 1.0 µg of total RNA was used to synthesize cDNA via reverse transcription (High Capacity cDNA Synthesis Kit, Applied Biosystems, Waltham, MA).
7
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wildtype and mutant strains were independently grown to the mid-log phase in YPD at the indicated temperature. Cells were harvested at 1000 × g for 5 min at 4 °C and were washed twice with ice-cold ddH2O. Total RNA was isolated using the Total RNA Kit I (Omega), and cDNA was synthesized using a Reverse Transcript All-in-one Mix (Mona), then the genomic DNA was removed using TURBO DNA-free™ (Invitrogen). Primers for amplifying target genes are shown in Supplementary Data 6 . Data were acquired on a CFX96 real-time system (Bio-Rad), and ACT1 expression was used as a normalization control. The ΔΔCt method was used to calculate relative gene expression.
8
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver or placenta using Ribopure (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). Total RNA was subjected to DNase I treatment using Turbo DNA-free (Invitrogen, ThermoFisher Scientific, USA), and RNA integrity was confirmed by agarose gel electrophoresis. Afterwards, cDNA was synthesized by oligo(dT)-primed reverse transcription with Superscript II (Invitrogen, ThermoFisher Scientific, USA). qPCRs were performed using a Light Cycler 1.5 (Roche, Mannheim, Germany). The reaction solution was carried out in a volume of 20 μL, containing 10 pmol of both forward and reverse primers, 10× SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan) and the appropriate nanograms of the cDNA stock. Rps29 was used as a reference gene for qPCR. The primer sequences were obtained either from the Atlas RT-PCR Primer Sequences (Clontech, Palo Alto, CA, USA) or designed using the Primer3 software (University of Massachusetts Medical School, Worcester, MA, USA) [33 (link)]. Samples were analyzed in duplicate on each assay. Amplification of non-specific targets was discarded using the melting curve analysis method for each amplicon. qPCR efficiency and linearity were assessed by optimization of the standard curves for each target. The transcription was quantified by the Light Cycler Software 4.05 (Roche, Germany) using the efficiency correction method [34 (link)].
9
RNA-Seq Analysis of 13 dpf Zebrafish Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted in TRIzol (Life Technologies) from whole pooled (15 individuals/sample) 13 dpf larvae or single livers isolated from WT (AB) fish and purified using the QIAGEN RNeasy Mini Kit. RNA quality was verified on the Agilent Bioanalyzer, and DNA contamination was removed with the TURBO DNA-free (Invitrogen, Thermo Fisher Scientific) kit. Single-end NextSeq Series high-output RNA-Seq was performed on poly(A) selected coding mRNAs at the Dana-Farber Center for Cancer Computational Biology.
10
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leaf tissues were collected from 3-week-old plants after the corresponding treatment at the indicated time points and total RNA was extracted using TRIzol Reagent according to the manufacture's instruction. Two microgram of the total RNA sample was treated with TURBO DNA-free (Cat No. AM1907, Invitrogen) to eliminate the genomic DNA contamination. Then cDNA was synthesized by SuperScript III reverse transcriptase (Cat No. 18080-044, Invitrogen) along with oligo-dT primers and analysed by quantitative reverse transcription PCR using SYBR Green Master with the gene specific primers listed in Supplementary Table 1 . The level of UBQ5 was used to normalize the expression of target genes. Data analysis was performed using mixed linear models in the R programming environment47 . Genotypes and treatments were used as fixed effects and replicate-specific effects were considered random effects. Modelled expression values between genotypes were compared using Student's t-test where indicated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!