RNA probes were synthesized as previously described (Heikes et al., 2023 (link); Smith, 2018 (link); Smith et al., 2016 (link)). Probes were labelled with either the DIG RNA labeling mix (Roche, Sigma product # 11277073910) or the Fluorescein RNA labeling mix (Roche, Sigma product # 11685619910) to facilitate double staining.
Fluorescein rna labeling mix
Manufactured by Roche
Sourced in Switzerland
Fluorescein RNA Labeling Mix is a reagent used for the fluorescent labeling of RNA molecules. It provides the necessary components for the incorporation of fluorescein-labeled nucleotides into RNA during in vitro transcription reactions.
Automatically generated - may contain errors
Lab products found in correlation
Dig rna labeling mix, by Roche (7 mentions)
Dig rna labeling kit, by Roche (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
T7 or sp6 rna polymerase, by Roche (2 mentions)
Megascript t7 transcription kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Anti fluorescein antibody, by Roche (1 mentions)
Rabbit anti gfp, by Thermo Fisher Scientific (1 mentions)
Fast red, by Abcam (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Digoxygenin, by Roche (1 mentions)
Bm purple, by Roche (1 mentions)
Bovine type b gelatin, by Merck Group (1 mentions)
Magenta phosphate, by Merck Group (1 mentions)
Rneasy mini kit, by Promega (1 mentions)
Digoxigenin dig, by Roche (1 mentions)
Biotaq dna polymerase, by Meridian Bioscience (1 mentions)
Pgem t easy, by Promega (1 mentions)
Poly a tailing kit, by Thermo Fisher Scientific (1 mentions)
22 protocols using fluorescein rna labeling mix
1
RNA Probe Synthesis and Labeling
2
Whole-mount in situ hybridization and immunofluorescence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were fixed in 4% paraformaldehyde (PFA) in PBS at specified times post-fertilization. Samples were permeabilized with 50 μg/ml Proteinase K for 30 minutes at room temperature. Samples were then prehybridized in HYB+ with 0.1% tween SSCT at 68°C followed by incubation with antisense probes against rprm or pdgfrβ that were labeled with either Dig—or Fluorescein RNA labeling MIX (Roche) over night. Probes were detected with anti-DIG or anti Fluorescein antibody (1:500) conjugated horseradish peroxidase (Roche). Signal was produced by treatment with TSA plus Cyanine 3/Fluorescein system (PerkinElmer). Immunofluorescence was completed using rabbit anti-GFP (1:500, Life technologies), and primary antibodies were detected using anti-rabbit antibody conjugated to Alexa-488/Alexa-647 (1:500, invitrogen).
3
In Situ Hybridization of Avian Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization experiments were performed as previously described (53 (link)). Antisense riboprobes were synthesized from linearized plasmids containing fragments of T. guttata coding sequences for candidate genes (primer sequences are provided in table S3). The Tbx5 probe was a gift from J. Gros (Pasteur Institute). Double in situ hybridizations were performed using riboprobes tagged with digoxigenin (DIG) or fluorescein RNA-labeling mix (Roche) and sequentially revealed using anti-DIG and anti-fluorescein alkaline phosphatase antibodies (Roche), followed by reaction on bromochloroindolyl phosphate–nitro blue tetrazolium (Promega) and Fast Red (Abcam) substrates.
4
In Vitro Transcription of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For in vitro transcription, plasmids containing the sequence of interest under the control of the T7 promoter were linearized by restriction digest, and 1 μg of purified digested DNA was used as a template for the reaction performed using the MEGAscript T7 Transcription Kit (Ambion, USA) as specified by the manufacturer and purified by LiCl precipitation. For the generation of ZIKV sfRNA and GFP RNA fragment, fluorescein-labeled RNA was prepared in parallel using Fluorescein RNA Labeling Mix (Roche, Switzerland) and mixed with unlabeled RNA in 1:10 ratio to serve as a tracer. RNA was then incubated with 10 U of RppH (NEB, USA) and 1 U of XRN-1 (NEB, USA) in NEB3 buffer for 1 hour at 37°C. RNA was then purified by phenol:chloroform extraction. All in vitro transcribed RNAs were analyzed by electrophoresis in 1.5% formaldehyde agarose gel, and RNA concentration was determined on a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). RNA was transfected into cells using an in-suspension protocol (58 (link)).
5
Cloning and Labeling of Taste Receptor Subunits
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA fragments of nAChR subunits α4, α7, β2, and β4 were obtained by RT-PCR from circumvallates (CV) and fungiform (FF) taste tissue of C57BL/6 mice or SD rats. The cDNA fragments were cloned into pSPT19 vector between EcoR I and Hind III restriction site. Plasmid DNAs were purified by using QIAprep Spin Miniprep Kit (Qiagen, Cat 27104) and sequenced at VCU DNA core lab. Template DNAs were digested with Nde I and transcribed by T7 RNA polymerase for antisense (AS) probes, or they were digested with Nhe I and transcribed by Sp6 RNA polymerase for sense (S) probes. Probes were generated with the DIG RNA Labeling kit (Roche Diagnostics USA, Cat number 11175025910) or Fluorescein RNA labeling Mix (Roche Diagnostics USA, Cat. Number 11685619910). Dot-blot assay were used to determine the labeling efficiency. Primers used for in situ hybridization probes are shown in Table 1 .
6
Whole Mount In Situ Hybridization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole mount in situ hybridization was carried out using standard protocols [21 (link)]. For preparation of antisense apoCI RNA probe, pBluescript SK+ 3–2 plasmid vector was linearized with Not I and transcribed in vitro with T7 RNA polymerase. For double in situ hybridization, probes were synthesized using digoxygenin or fluorescein RNA labeling mix (Roche) and detected with corresponding antibodies (Roche). First antibody reactions were quenched using 0.1M glycine-HCl, pH2.2 [22 (link)]. Magenta phosphate (Sigma), BCIP (Roche) and BM Purple (Roche) were used for chromogenic reactions. Other probes used in this study were Otx-A, Pax-6 and Slug [23 (link), 24 (link)]. 40 μM vibratome sections were obtained by embedding 4% paraformaldehyde-fixed embryos in 20% type B Bovine Gelatin (Sigma).
7
Dual-Color Fluorescent In Situ Hybridization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization was performed, as described previously (Bessho et al., 2001 (link)). For dual-color fluorescent in situ hybridization, Uncx4.1 probe was labeled with digoxigenin (DIG) using DIG RNA Labeling Mix (Roche), and Hes7 probe was labeled with fluorescein using Fluorescein RNA Labeling Mix (Roche). After hybridization with these probes, samples were incubated with anti-DIG Fab fragments conjugated to horseradish peroxidase (HRP) and subjected to tyramide signal amplification (TSA-Cy3 for DIG-labeled probe, Perkin Elmer). Then, after inactivation of HRP by 3% H2O2, samples were incubated with anti-Fluorescein Fab fragments conjugated to HRP and subjected to tyramide signal amplification (TSA-Fluorescein for Fluorescein-labeled probe, Perkin Elmer).
8
Oocyte RNA Isolation and cDNA Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from oocytes using the RNeasy MiniKit (Promega) according to manufactures protocol. cDNA synthesis was performed with 0.5 μg total RNA and primed with random decamers using SuperScript® III reverse transcriptase (Invitrogen). PCR was performed with BioTaq DNA polymerase (Bioline) the amplified fragments were purified using the Qiaquick Gel extraction Kit (Qiagen) and cloned into the in vitro transcription vector pGEM® T-Easy (Promega). Linearized templates were prepared, and in vitro transcription reactions performed in the presence of digoxigenin DIG or fluorescein RNA Labeling Mix (Roche Applied Science). Accession numbers for genes involved in this study: vas1 (CBY22958.1), vas2 (CBY18436.1), vas3 (CBY23797.1), vas4 (CBY13641.1), pum1 (CBY19123.1), and pum2 (CBY18164.1).
9
mRNA Synthesis and Fluorescent Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The iDab-P2A-EGFP fragment was PCR-amplified using forward primer
5′-GGGTTTTATGCGATGGAGTTTC-3′ and reverse primer 5′-AAGAAAGCGAAAGGAGCG-3′
from the pJEF-iDab-2A-2EGP plasmid. The PCR products were used for
mRNA synthesis. The mMESSAGE mMACHINE Kit (Invitrogen AM1344) was
used for in vitro transcription using native NTPs.
The MEGAscript T7 Transcription Kit (Invitrogen AM1333) was used for
mRNA synthesis using ARCA (NEB S1411S) and pseudo-UTP (Jena Bioscience
NU-1139S) with a modified protocol. The reaction (1 μg of PCR
product, 7.5 mM of ATP, CTP, and pseudo-UTP, 1.5 mM of GTP, 6 mM of
ARCA, 2 μL of 10× reaction buffer and 2 μL of enzyme
mix) was diluted to 20 μL of the final volume with nuclease-free
water and incubated at 37 °C for 4 h followed by TURBO DNase
(final concentration of 2 U/μL) treatment at 37 °C for
15 min. A poly(A) tail was added to the synthesized mRNA using a poly(A)
Tailing Kit (Invitrogen AM1350). The fluorescently labeled mRNA was
also synthesized with the MEGAscript T7 Transcription Kit following
the steps described above except the 10× concentrated Fluorescein
RNA Labeling Mix (ROCHE 11685619910) was used as the NTP mixture. The fluorescently labeled mRNA was synthesized without
poly(A) tailing. Synthesized mRNA was purified using RNeasy Plus Mini
Kit (Qiagen 74134) and the concentration was measured using NanoDrop
ND-8000.
5′-GGGTTTTATGCGATGGAGTTTC-3′ and reverse primer 5′-AAGAAAGCGAAAGGAGCG-3′
from the pJEF-iDab-2A-2EGP plasmid. The PCR products were used for
mRNA synthesis. The mMESSAGE mMACHINE Kit (Invitrogen AM1344) was
used for in vitro transcription using native NTPs.
The MEGAscript T7 Transcription Kit (Invitrogen AM1333) was used for
mRNA synthesis using ARCA (NEB S1411S) and pseudo-UTP (Jena Bioscience
NU-1139S) with a modified protocol. The reaction (1 μg of PCR
product, 7.5 mM of ATP, CTP, and pseudo-UTP, 1.5 mM of GTP, 6 mM of
ARCA, 2 μL of 10× reaction buffer and 2 μL of enzyme
mix) was diluted to 20 μL of the final volume with nuclease-free
water and incubated at 37 °C for 4 h followed by TURBO DNase
(final concentration of 2 U/μL) treatment at 37 °C for
15 min. A poly(A) tail was added to the synthesized mRNA using a poly(A)
Tailing Kit (Invitrogen AM1350). The fluorescently labeled mRNA was
also synthesized with the MEGAscript T7 Transcription Kit following
the steps described above except the 10× concentrated Fluorescein
RNA Labeling Mix (ROCHE 11685619910) was used as the NTP mixture. The fluorescently labeled mRNA was synthesized without
poly(A) tailing. Synthesized mRNA was purified using RNeasy Plus Mini
Kit (Qiagen 74134) and the concentration was measured using NanoDrop
ND-8000.
10
Cloning and Labeling of NPY, CART, and pOX
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NPY, CART, and pOX sequences were retrieved from GeneBank sequence database (NCBI) with accession number AY822596, DQ167209, and DQ486137, respectively. cDNA sequence fragments of NPY (346 bp), CART (300 bp), and pOX (453bp) were synthesized from total RNA extracted from cod brain, using oligo(dT)12-18 primer and Superscript III (Invitrogen, Carlsbad, CA, USA), by standard procedures. The primers used were: ggaactctgaccgagggat NPY(F) and gccctctgatgacaaatca NPY(R) for NPY; gagtgtggaccagagccttg CART(F) and gcagtcacacatcttcccaat CART(R) for CART; aatgaagtggtcctccacagtgt Orex(F) and tcaagcggtgaagtcttgctgc Orex(R) for pOX. PCR amplification was performed with an initial step of 94°C for 5 min, 30 cycles of 94°C for 25s, 55°C for 30s, 68°C for 90s and extension at 68°C for 7 min. PCR products were purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into TOPO cloning vector (Invitrogen). The inserts were sequenced at the University of Bergen Sequencing Facility, and used to synthesize antisense and sense (control) probes with digoxigenin (DIG RNA labeling mix, Roche Diagnostic) and fluorescein (Fluorescein RNA Labeling Mix, Roche Diagnostic) haptens for ISH methods.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!